ATF3 (NM_001206488) Human Untagged Clone

CAT#: SC329813

ATF3 (untagged) - Homo sapiens activating transcription factor 3 (ATF3), transcript variant 8



  "NM_001206488" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
ATF3 mouse monoclonal antibody, clone OTI5G9 (formerly 5G9)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC329813 representing NM_001206488.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCCTCTGCGCTGGAATCAGTCACTGTCAGCGACAGACCCCTCGGGGTGTCCATCACAAAAGCCGAG
GTAGCCCCTGAAGAAGATGAAAGGAAAAAGAGGCGACGAGAAAGAAATAAGATTGCAGCTGCAAAGTGC
CGAAACAAGAAGAAGGAGAAGACGGAGTGCCTGCAGAAAGAGTCGGAGAAGCTGGAAAGTGTGAATGCT
GAACTGAAGGCTCAGATTGAGGAGCTCAAGAACGAGAAGCAGCATTTGATATACATGCTCAACCTTCAT
CGGCCCACGTGTATTGTCCGGGCTCAGAATGGGAGGACTCCAGAAGATGAGAGAAACCTCTTTATCCAA
CAGATAAAAGAAGGAACATTGCAGAGCTAA

Restriction Sites SgfI-MluI     
ACCN NM_001206488
Insert Size 375 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001206488.2
RefSeq Size 2065 bp
RefSeq ORF 375 bp
Locus ID 467
UniProt ID P18847
Protein Families Transcription Factors
MW 14.3 kDa
Gene Summary This gene encodes a member of the mammalian activation transcription factor/cAMP responsive element-binding (CREB) protein family of transcription factors. This gene is induced by a variety of signals, including many of those encountered by cancer cells, and is involved in the complex process of cellular stress response. Multiple transcript variants encoding different isoforms have been found for this gene. It is possible that alternative splicing of this gene may be physiologically important in the regulation of target genes. [provided by RefSeq, Apr 2011]
Transcript Variant: This variant (8) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (3) is shorter at the N-terminus, compared to isoform 1. Both variants 5 and 8 encode isoform 3.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...