Bif (SH3GLB1) (NM_001206651) Human Untagged Clone

CAT#: SC329824

SH3GLB1 (untagged) - Homo sapiens SH3-domain GRB2-like endophilin B1 (SH3GLB1), transcript variant 2



  "NM_001206651" in other vectors (2)

CNY 3800.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-SH3GLB1 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Bif-1; CGI-61; dJ612B15.2; PPP1R70
Vector pCMV6-Entry
Sequence Data
>SC329824 representing NM_001206651.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAATATCATGGACTTCAACGTGAAGAAGCTGGCGGCCGACGCAGGCACCTTCCTCAGTCGCGCCGTG
CAGTTCACAGAAGAAAAGCTTGGCCAGGCTGAGAAGACAGAATTGGATGCTCACTTAGAGAACCTCCTT
AGCAAAGCTGAATGTACCAAAATATGGACAGAAAAAATAATGAAACAAACTGAAGTGTTATTGCAGCCA
AATCCAAATGCCAGGATAGAAGAATTTGTTTATGAGAAACTGGATAGAAAAGCTCCAAGTCGTATAAAC
AACCCAGAACTTTTGGGACAATATATGATTGATGCAGGGACTGAGTTTGGCCCAGGAACAGCTTATGGT
AATGCCCTTATTAAATGTGGAGAAACCCAAAAAAGAATTGGAACAGCAGACAGAGAACTGATTCAAACG
TCAGCCTTAAATTTTCTTACTCCTTTAAGAAACTTTATAGAAGGAGATTACAAAACAATTGCTAAAGAA
AGGAAACTATTGCAAAATAAGAGACTGGATTTGGATGCTGCAAAAACGAGACTAAAAAAGGCAAAAGCT
GCAGAAACTAGAAATTCACAACTAAACTCAGCTCGCCTTGAAGGAGATAACATTATGGTAAATTTCTCT
TACATGCTCAACTTCCTGCATGTAAAATGGCTGAAGTCTGAACAGGAATTAAGAATAACTCAAAGTGAA
TTTGATCGTCAAGCAGAGATTACCAGACTTCTGCTAGAGGGAATCAGCAGTACACATGCCCATCACCTT
CGCTGTCTGAATGACTTTGTAGAAGCCCAGATGACTTACTATGCACAGTGTTACCAGTATATGTTGGAC
CTCCAGAAACAACTGGGAAGTTTTCCATCCAATTATCTTAGTAACAACAATCAGACTTCTGTGACACCT
GTACCATCAGTTTTACCAAATGCGATTGGTTCTTCTGCCATGGCTTCAACAAGTGGCCTAGTAATCACC
TCTCCTTCCAACCTCAGTGACCTTAAGGAGTGTAGTGGCAGCAGAAAGGCCAGGGTTCTCTATGATTAT
GATGCAGCAAACAGTACTGAATTATCACTTCTGGCAGATGAGGTGATCACTGTGTTCAGTGTTGTTGGA
ATGGATTCAGACTGGCTAATGGGGGAAAGGGGAAACCAGAAGGGCAAGGTGCCAATTACCTACTTAGAA
CTGCTCAATTAA

Restriction Sites SgfI-MluI     
ACCN NM_001206651
Insert Size 1185 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001206651.1
RefSeq Size 6469 bp
RefSeq ORF 1185 bp
Locus ID 51100
UniProt ID Q9Y371
Protein Pathways Endocytosis
MW 44.3 kDa
Gene Summary This gene encodes a SRC homology 3 domain-containing protein. The encoded protein interacts with the proapoptotic member of the Bcl-2 family, Bcl-2-associated X protein (Bax) and may be involved in regulating apoptotic signaling pathways. This protein may also be involved in maintaining mitochondrial morphology. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (2) has an additional in-frame exon in the CDS, compared to variant 1. The resulting isoform (2) has an additional segment, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...