AMPK gamma 1 (PRKAG1) (NM_001206710) Human Untagged Clone

CAT#: SC329832

PRKAG1 (untagged) - Homo sapiens protein kinase, AMP-activated, gamma 1 non-catalytic subunit (PRKAG1), transcript variant 4



  "NM_001206710" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
PRKAG1 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AMPKG
Vector pCMV6-Entry
Sequence Data
>SC329832 representing NM_001206710.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAGTCTCATCGCTGCTATGACCTGATTCCCACAAGCTCCAAATTGGTTGTATTTGATACGTCCCTG
CAGGTGAAGAAAGCTTTTTTTGCTTTGGTGACTAACGGTGTACGAGCTGCCCCTTTATGGGATAGTAAG
AAGCAAAGTTTTGTGGGCATGCTGACCATCACTGATTTCATCAATATCCTGCACCGCTACTATAAATCA
GCCTTGGTACAGATCTATGAGCTAGAAGAACACAAGATAGAAACTTGGAGAGAGGTGTATCTCCAGGAC
TCCTTTAAACCGCTTGTCTGCATTTCTCCTAATGCCAGCTTGTTTGATGCTGTCTCTTCATTAATTCGG
AACAAGATCCACAGGCTGCCAGTTATTGACCCAGAATCAGGCAATACTTTGTACATCCTCACCCACAAG
CGCATTCTGAAGTTCCTCAAATTGTTTATCACTGAGTTCCCCAAGCCAGAGTTCATGTCCAAGTCTCTG
GAAGAGCTACAGATTGGCACCTATGCCAATATTGCTATGGTTCGCACTACCACCCCCGTCTATGTGGCT
CTGGGGATTTTTGTACAGCATCGAGTCTCAGCCCTGCCAGTGGTGGATGAGAAGGGGCGTGTGGTGGAC
ATCTACTCCAAGTTTGATGTTATCAATCTGGCAGCAGAAAAGACCTACAACAACCTAGATGTATCTGTG
ACTAAAGCCTTGCAACATCGATCACATTACTTTGAGGGTGTTCTCAAGTGCTACCTGCATGAGACTCTG
GAGACCATCATCAACAGGCTAGTGGAAGCAGAGGTTCACCGACTTGTAGTGGTGGATGAAAATGATGTG
GTCAAGGGAATTGTATCACTGTCTGACATCCTGCAGGCCCTGGTGCTCACAGGTGGAGAGAAGAAGCCC
TGA

Restriction Sites SgfI-MluI     
ACCN NM_001206710
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001206710.1
RefSeq Size 1854 bp
RefSeq ORF 900 bp
Locus ID 5571
UniProt ID P54619
Protein Families Druggable Genome
Protein Pathways Adipocytokine signaling pathway, Hypertrophic cardiomyopathy (HCM), Insulin signaling pathway
MW 34.1 kDa
Gene Summary The protein encoded by this gene is a regulatory subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This subunit is one of the gamma regulatory subunits of AMPK. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) differs in the 5' UTR and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (4) is shorter at the N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...