NCR1 (NM_001242357) Human Untagged Clone

CAT#: SC329936

NCR1 (untagged) - Homo sapiens natural cytotoxicity triggering receptor 1 (NCR1), transcript variant 5



  "NM_001242357" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-NCR1 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD335; LY94; NK-p46; NKP46
Vector pCMV6-Entry
Sequence Data
>SC329936 representing NM_001242357.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCTTCCACACTCCCTGCCCTGCTCTGCGTCGGGCTGTGTCTGAGTCAGAGGATCAGCGCCCAGCAG
CAAATGTATGACACACCCACCCTCTCGGTTCATCCTGGACCCGAAGTGATCTCGGGAGAGAAGGTGACC
TTCTACTGCCGTCTAGACACTGCAACAAGCATGTTCTTACTGCTCAAGGAGGGAAGATCCAGCCACGTA
CAGCGCGGATACGGGAAGGTCCAGGCGGAGTTCCCCCTGGGCCCTGTGACCACAGCCCACAGAGGGACA
TACCGATGTTTTGGCTCCTATAACAACCATGCCTGGTCTTTCCCCAGTGAGCCAGTGAAGCTCCTGGTC
ACAGGCGACATTGAGAACACCAGCCTTGCACCTGAAGACCCCACCTTTCCTGACCATGCCCTCTGGGAT
CACACTGCCCAGAATCTCCTTCGGATGGGCCTGGCCTTTCTAGTCCTGGTGGCTCTAGTGTGGTTCCTG
GTTGAAGACTGGCTCAGCAGGAAGAGGACTAGAGAGCGAGCCAGCAGAGCTTCCACTTGGGAAGGCAGG
AGAAGGCTGAACACACAGACTCTTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001242357
Insert Size 579 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001242357.2
RefSeq Size 817 bp
RefSeq ORF 579 bp
Locus ID 9437
UniProt ID O76036
Protein Families Druggable Genome, Transmembrane
Protein Pathways Natural killer cell mediated cytotoxicity
MW 21.6 kDa
Gene Summary Cytotoxicity-activating receptor that may contribute to the increased efficiency of activated natural killer (NK) cells to mediate tumor cell lysis.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) lacks two alternate exons in the coding region compared to variant 1. The resulting protein (isoform e) is shorter but has the same N- and C-termini compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...