TREM1 (NM_001242589) Human Untagged Clone

CAT#: SC329988

TREM1 (untagged) - Homo sapiens triggering receptor expressed on myeloid cells 1 (TREM1), transcript variant 2



  "NM_001242589" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


TREM1 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD354; TREM-1
Vector pCMV6-Entry
Sequence Data
>SC329988 representing NM_001242589.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGGAAGACCAGGCTCTGGGGGCTGCTGTGGATGCTCTTTGTCTCAGAACTCCGAGCTGCAACTAAA
TTAACTGAGGAAAAGTATGAACTGAAAGAGGGGCAGACCCTGGATGTGAAATGTGACTACACGCTAGAG
AAGTTTGCCAGCAGCCAGAAAGCTTGGCAGATAATAAGGGACGGAGAGATGCCCAAGACCCTGGCATGC
ACAGAGAGGCCTTCAAAGAATTCCCATCCAGTCCAAGTGGGGAGGATCATACTAGAAGACTACCATGAT
CATGGTTTACTGCGCGTCCGAATGGTCAACCTTCAAGTGGAAGATTCTGGACTGTATCAGTGTGTGATC
TACCAGCCTCCCAAGGAGCCTCACATGCTGTTCGATCGCATCCGCTTGGTGGTGACCAAGGGTTTTTCA
GGGACCCCTGGCTCCAATGAGAATTCTACCCAGAATGTGTATAAGATTCCTCCTACCACCACTAAGGCC
TTGTGCCCACTCTATACCAGCCCCAGAACTGTGACCCAAGCTCCACCCAAGTCAACTGCCGATGTCTCC
ACTCCTGACTCTGAAATCAACCTTACAAATGTGACAGATATCATCAGGTATAGTTTCCAGGTCCCTGGG
CCCCTGGTTTGGACACTGAGCCCTTTGTTTCCCAGTCTGTGTGCTGAGAGGATGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001242589
Insert Size 678 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001242589.1
RefSeq Size 2102 bp
RefSeq ORF 678 bp
Locus ID 54210
UniProt ID Q9NP99
Protein Families Druggable Genome, Secreted Protein, Transmembrane
MW 25.6 kDa
Gene Summary This gene encodes a receptor belonging to the Ig superfamily that is expressed on myeloid cells. This protein amplifies neutrophil and monocyte-mediated inflammatory responses triggered by bacterial and fungal infections by stimulating release of pro-inflammatory chemokines and cytokines, as well as increased surface expression of cell activation markers. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jun 2011]
Transcript Variant: This variant (2) differs at the 3' end compared to variant 1. This results in a shorter isoform (2) with a distinct C-terminus, lacking the transmembrane domain, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...