BTN3A3 (NM_001242803) Human Untagged Clone

CAT#: SC330018

BTN3A3 (untagged) - Homo sapiens butyrophilin, subfamily 3, member A3 (BTN3A3), transcript variant 3



  "NM_001242803" in other vectors (2)

CNY 3610.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BTF3; BTN3.3
Vector pCMV6-Entry
Sequence Data
>SC330018 representing NM_001242803.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGGGTGAAGACGCTGATCTGCCCTGTCACCTGTTCCCGACCATGAGTGCAGAGACCATGGAGCTG
AGGTGGGTGAGTTCCAGCCTAAGGCAGGTGGTGAACGTGTATGCAGATGGAAAGGAAGTGGAAGACAGG
CAGAGTGCACCGTATCGAGGGAGAACTTCGATTCTGCGGGATGGCATCACTGCAGGGAAGGCTGCTCTC
CGAATACACAACGTCACAGCCTCTGACAGTGGAAAGTACTTGTGTTATTTCCAAGATGGTGACTTCTAC
GAAAAAGCCCTGGTGGAGCTGAAGGTTGCAGAGTGGAGGAAAATCCAGTACATGGCTCGTGGAGAGAAG
TCTTTGGCCTATCATGAATGGAAAATGGCCCTCTTCAAACCTGCGGATGTGATTCTGGATCCAGACACG
GCAAACGCCATCCTCCTTGTTTCTGAGGACCAGAGGAGTGTGCAGCGTGCTGAAGAGCCGCGGGATCTG
CCAGACAACCCTGAGAGATTTGAATGGCGTTACTGTGTCCTTGGCTGTGAAAACTTCACATCAGGGAGA
CATTACTGGGAGGTGGAAGTGGGGGACAGAAAAGAGTGGCATATTGGGGTATGTAGTAAGAACGTGGAG
AGGAAAAAAGGTTGGGTCAAAATGACACCGGAGAACGGATACTGGACTATGGGCCTGACTGATGGGAAT
AAGTATCGGGCTCTCACTGAGCCCAGAACCAACCTGAAACTTCCTGAGCCTCCTAGGAAAGTGGGGATC
TTCCTGGACTATGAGACTGGAGAGATCTCGTTCTATAATGCCACAGATGGATCTCATATCTACACCTTT
CCGCACGCCTCTTTCTCTGAGCCTCTATATCCTGTTTTCAGAATTTTGACCTTGGAGCCCACTGCCCTG
ACCATTTGCCCAATACCAAAAGAAGTAGAGAGTTCCCCCGATCCTGACCTAGTGCCTGATCATTCCCTG
GAGACACCACTGACCCCGGGCTTAGCTAATGAAAGTGGGGAGCCTCAGGCTGAAGTAACATCTCTGCTT
CTCCCTGCCCACCCTGGAGCTGAGGTCTCCCCTTCTGCAACAACCAATCAGAACCATAAGCTACAGGCA
CGCACTGAAGCACTTTACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001242803
Insert Size 1125 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001242803.1
RefSeq Size 2364 bp
RefSeq ORF 1125 bp
Locus ID 10384
UniProt ID O00478
Protein Families Druggable Genome, Transmembrane
MW 42.3 kDa
Gene Summary The butyrophilin (BTN) genes are a group of major histocompatibility complex (MHC)-associated genes that encode type I membrane proteins with 2 extracellular immunoglobulin (Ig) domains and an intracellular B30.2 (PRYSPRY) domain. Three subfamilies of human BTN genes are located in the MHC class I region: the single-copy BTN1A1 gene (MIM 601610) and the BTN2 (e.g., BTN2A1; MIM 613590) and BTN3 (e.g., BNT3A3) genes, which have undergone tandem duplication, resulting in 3 copies of each (summary by Smith et al., 2010 [PubMed 20208008]).[supplied by OMIM, Nov 2010]
Transcript Variant: This variant (3) lacks several exons in two regions, but the open reading frame is retained, compared to variant 1. The encoded isoform (c) has a shorter N-terminus and lacks an internal segment, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...