ELOVL5 (NM_001242831) Human Untagged Clone

CAT#: SC330025

ELOVL5 (untagged) - Homo sapiens ELOVL fatty acid elongase 5 (ELOVL5), transcript variant 4



  "NM_001242831" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit polyclonal anti-ELOVL5 antibody
    • 100 ul

CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms dJ483K16.1; HELO1; SCA38
Vector pCMV6-Entry
Sequence Data
>SC330025 representing NM_001242831.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAACATTTTGATGCATCACTTAGTACCTATTTCAAGGCATTGCTAGGCCCTCGAGGTATCAGCAGC
TCTGTCCTCAGAATGGGTCCCCCACTTCACACAGTTGTAGGATGGCTACAGCAGCTCCAAGCAGCACAT
TCAGAGGAAGAAGAAAAAATGTTTCATTTGTGTGGTTTTAAGCATAAAGAAGTTGTTTCCCAGAGCTCT
TTGCCAGCTGTCATCCCTCAAAACTCACTGGCCACAATTGCTTCACATGCCCCTGCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001242831
Insert Size 267 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001242831.1
RefSeq Size 849 bp
RefSeq ORF 267 bp
Locus ID 60481
UniProt ID Q9NYP7
Protein Families Transmembrane
Protein Pathways Biosynthesis of unsaturated fatty acids
MW 9.6 kDa
Gene Summary This gene belongs to the ELO family. It is highly expressed in the adrenal gland and testis, and encodes a multi-pass membrane protein that is localized in the endoplasmic reticulum. This protein is involved in the elongation of long-chain polyunsaturated fatty acids. Mutations in this gene have been associated with spinocerebellar ataxia-38 (SCA38). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (4) lacks several 3' exons and contains a novel 3' terminal exon compared to variant 1. The resulting isoform (4) is shorter with a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...