AKT2 (NM_001243028) Human Untagged Clone

CAT#: SC330075

AKT2 (untagged) - Homo sapiens v-akt murine thymoma viral oncogene homolog 2 (AKT2), transcript variant 3



  "NM_001243028" in other vectors (2)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
AKT2 mouse monoclonal antibody, clone OTI4H7 (formerly 4H7)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HIHGHH; PKBB; PKBBETA; PRKBB; RAC-BETA
Vector pCMV6-Entry
Sequence Data
>SC330075 representing NM_001243028.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAGACCGAGAGGCCGCGACCCAACACCTTTGTCATACGCTGCCTGCAGTGGACCACAGTCATCGAG
AGGACCTTCCACGTGGATTCTCCAGACGAGAGGGAGGAGTGGATGCGGGCCATCCAGATGGTCGCCAAC
AGCCTCAAGCAGCGGGCCCCAGGCGAGGACCCCATGGACTACAAGTGTGGCTCCCCCAGTGACTCCTCC
ACGACTGAGGAGATGGAAGTGGCGGTCAGCAAGGCACGGGCTAAAGTGACCATGAATGACTTCGACTAT
CTCAAACTCCTTGGCAAGGGAACCTTTGGCAAAGTCATCCTGGTGCGGGAGAAGGCCACTGGCCGCTAC
TACGCCATGAAGATCCTGCGGAAGGAAGTCATCATTGCCAAGGATGAAGTCGCTCACACAGTCACCGAG
AGCCGGGTCCTCCAGAACACCAGGCACCCGTTCCTCACTGCGCTGAAGTATGCCTTCCAGACCCACGAC
CGCCTGTGCTTTGTGATGGAGTATGCCAACGGGGGTGAGCTGTTCTTCCACCTGTCCCGGGAGCGTGTC
TTCACAGAGGAGCGGGCCCGGTTTTATGGTGCAGAGATTGTCTCGGCTCTTGAGTACTTGCACTCGCGG
GACGTGGTATACCGCGACATCAAGCTGGAAAACCTCATGCTGGACAAAGATGGCCACATCAAGATCACT
GACTTTGGCCTCTGCAAAGAGGGCATCAGTGACGGGGCCACCATGAAAACCTTCTGTGGGACCCCGGAG
TACCTGGCGCCTGAGGTGCTGGAGGACAATGACTATGGCCGGGCCGTGGACTGGTGGGGGCTGGGTGTG
GTCATGTACGAGATGATGTGCGGCCGCCTGCCCTTCTACAACCAGGACCACGAGCGCCTCTTCGAGCTC
ATCCTCATGGAAGAGATCCGCTTCCCGCGCACGCTCAGCCCCGAGGCCAAGTCCCTGCTTGCTGGGCTG
CTTAAGAAGGACCCCAAGCAGAGGCTTGGTGGGGGGCCCAGCGATGCCAAGGAGGTCATGGAGCACAGG
TTCTTCCTCAGCATCAACTGGCAGGACGTGGTCCAGAAGAAGCTCCTGCCACCCTTCAAACCTCAGGTC
ACGTCCGAGGTCGACACAAGGTACTTCGATGATGAATTTACCGCCCAGTCCATCACAATCACACCCCCT
GACCGCTATGACAGCCTGGGCTTACTGGAGCTGGACCAGCGGACCCACTTCCCCCAGTTCTCCTACTCG
GCCAGCATCCGCGAGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243028
Insert Size 1260 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001243028.1
RefSeq Size 5187 bp
RefSeq ORF 1260 bp
Locus ID 208
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Protein Kinase
Protein Pathways Acute myeloid leukemia, Adipocytokine signaling pathway, Apoptosis, B cell receptor signaling pathway, Chemokine signaling pathway, Chronic myeloid leukemia, Colorectal cancer, Endometrial cancer, ErbB signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Focal adhesion, Glioma, Insulin signaling pathway, Jak-STAT signaling pathway, MAPK signaling pathway, Melanoma, mTOR signaling pathway, Neurotrophin signaling pathway, Non-small cell lung cancer, Pancreatic cancer, Pathways in cancer, Progesterone-mediated oocyte maturation, Prostate cancer, Renal cell carcinoma, Small cell lung cancer, T cell receptor signaling pathway, Tight junction, Toll-like receptor signaling pathway, VEGF signaling pathway
MW 48.5 kDa
Gene Summary This gene is a putative oncogene encoding a protein belonging to a subfamily of serine/threonine kinases containing SH2-like (Src homology 2-like) domains, which is involved in signaling pathways. The gene serves as an oncogene in the tumorigenesis of cancer cells For example, its overexpression contributes to the malignant phenotype of a subset of human ductal pancreatic cancers. The encoded protein is a general protein kinase capable of phophorylating several known proteins, and has also been implicated in insulin signaling. [provided by RefSeq, Nov 2019]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks an alternate exon in the 5' coding region, and initiates translation at a downstream AUG. This results in a protein (isoform 2) with a shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...