SKP2 (NM_001243120) Human Untagged Clone

CAT#: SC330085

SKP2 (untagged) - Homo sapiens S-phase kinase-associated protein 2, E3 ubiquitin protein ligase (SKP2), transcript variant 3



  "NM_001243120" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
SKP2 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FBL1; FBXL1; FLB1; p45
Vector pCMV6-Entry
Sequence Data
>SC330085 representing NM_001243120.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGACCAACCATTGGCTGAACATTTCAGTACTCTCGCAAAAAACTCAAATTTAGTGCGACTTAACCTT
TCTGGGTGTTCTGGATTCTCTGAATTTGCCCTGCAGACTTTGCTAAGCAGCTGTTCCAGACTGGATGAG
CTGAACCTCTCCTGGTGTTTTGATTTCACTGAAAAGCATGTACAGGTGGCTGTTGCGCATGTGTCAGAG
ACCATCACCCAGCTGAATCTTAGCGGCTACAGAAAGAATCTCCAGAAATCAGATCTCTCTACTTTAGTT
AGAAGATGCCCCAATCTTGTCCATCTAGACTTAAGTGATAGTGTCATGCTAAAGAATGACTGCTTTCAG
GAATTTTTCCAGCTCAACTACCTCCAACACCTATCACTCAGTCGGTGCTATGATATAATACCTGAAACT
TTACTTGAACTTGGAGAAATTCCCACACTAAAAACACTACAAGTTTTTGGAATCGTGCCAGATGGTACC
CTTCAACTGTTAAAGGAAGCCCTTCCTCATCTACAGATTAATTGCTCCCATTTCACCACCATTGCCAGG
CCAACTATTGGCAACAAAAAGAACCAGGAGATATGGGGCATCAAATGCCGACTGACACTGCAAAAGCCC
AGTTGTCTATGA

Restriction Sites SgfI-MluI     
ACCN NM_001243120
Insert Size 633 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001243120.1
RefSeq Size 3273 bp
RefSeq ORF 633 bp
Locus ID 6502
UniProt ID Q13309
Protein Families Druggable Genome
Protein Pathways Acute myeloid leukemia, Apoptosis, Cell cycle, Oocyte meiosis, p53 signaling pathway, Pathways in cancer, Progesterone-mediated oocyte maturation, Small cell lung cancer, Ubiquitin mediated proteolysis
MW 23.8 kDa
Gene Summary This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class; in addition to an F-box, this protein contains 10 tandem leucine-rich repeats. This protein is an essential element of the cyclin A-CDK2 S-phase kinase. It specifically recognizes phosphorylated cyclin-dependent kinase inhibitor 1B (CDKN1B, also referred to as p27 or KIP1) predominantly in S phase and interacts with S-phase kinase-associated protein 1 (SKP1 or p19). In addition, this gene is established as a protooncogene causally involved in the pathogenesis of lymphomas. Alternative splicing of this gene generates three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2011]
Transcript Variant: This variant (3) lacks two alternate coding exons compared to variant 1. The first causes the translation start site to move downstream while the second is in-frame. The resulting isoform (3) is shorter at the N-terminus and lacks an alternate internal segment compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...