FA20A (FAM20A) (NM_001243746) Human Untagged Clone

CAT#: SC330170

FAM20A (untagged) - Homo sapiens family with sequence similarity 20, member A (FAM20A), transcript variant 3



  "NM_001243746" in other vectors (2)

CNY 3800.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
FAM20A Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AI1G; AIGFS; FP2747
Vector pCMV6-Entry
Sequence Data
>SC330170 representing NM_001243746.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTACAGAGAGCAGATGAACCTTACCTCCCTGGACCCCCCACTGCAGCTCCGACTCGAGGCCAGCTGG
GTCCAGTTCCACCTGGGTATTAACCGCCATGGGCTCTACTCCCGGTCCAGCCCTGTTGTCAGCAAACTT
CTGCAAGACATGAGGCACTTTCCCACCATCAGTGCTGATTACAGTCAAGATGAGAAAGCCTTGCTGGGG
GCATGTGACTGCACCCAGATTGTGAAACCCAGTGGGGTCCACCTCAAGCTGGTGCTGAGGTTCTCGGAT
TTCGGGAAGGCCATGTTCAAACCCATGAGACAGCAGCGAGATGAGGAGACACCAGTGGACTTCTTCTAC
TTCATTGACTTTCAGAGACACAATGCTGAGATCGCAGCTTTCCATCTGGACAGGATTCTGGACTTCCGA
CGGGTGCCGCCAACAGTGGGGAGGATAGTAAATGTCACCAAGGAAATCCTAGAGGTCACCAAGAATGAA
ATCCTGCAGAGTGTTTTCTTTGTCTCTCCAGCGAGCAACGTGTGCTTCTTCGCCAAGTGTCCATACATG
TGCAAGACGGAGTATGCTGTCTGTGGCAACCCACACCTGCTGGAGGGTTCCCTCTCTGCCTTCCTGCCG
TCCCTCAACCTGGCCCCCAGGCTGTCTGTGCCCAACCCCTGGATCCGCTCCTACACACTGGCAGGAAAA
GAGGAGTGGGAGGTCAATCCCCTTTACTGTGACACAGTGAAACAGATCTACCCGTACAACAACAGCCAG
CGGCTCCTCAATGTCATCGACATGGCCATCTTCGACTTCTTGATAGGGAATATGGACCGGCACCATTAT
GAGATGTTCACCAAGTTCGGGGATGATGGGTTCCTTATTCACCTTGACAACGCCAGAGGGTTCGGACGA
CACTCCCATGATGAAATCTCCATCCTCTCGCCTCTCTCCCAGTGCTGCATGATAAAAAAGAAAACACTT
TTGCACCTGCAGCTGCTGGCCCAAGCTGACTACAGACTCAGCGATGTGATGCGAGAATCACTGCTGGAA
GACCAGCTCAGCCCTGTCCTCACTGAACCCCACCTCCTTGCCCTGGATCGAAGGCTCCAAACCATCCTA
AGGACAGTGGAGGGGTGCATAGTGGCCCATGGACAGCAGAGTGTCATAGTCGACGGCCCAGTGGAACAG
TTGGCCCCAGACTCTGGCCAGGCTAACTTGACAAGCTAA

Restriction Sites SgfI-MluI     
ACCN NM_001243746
Insert Size 1212 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001243746.1
RefSeq Size 4511 bp
RefSeq ORF 1212 bp
Locus ID 54757
UniProt ID Q96MK3
Protein Families Secreted Protein, Transmembrane
MW 46 kDa
Gene Summary This locus encodes a protein that is likely secreted and may function in hematopoiesis. A mutation at this locus has been associated with amelogenesis imperfecta and gingival hyperplasia syndrome. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (3) contains an alternate exon at its 5' end and uses a downstream start codon, compared to variant 1. The encoded protein (isoform b) has a shorter N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...