APH1A (NM_001243771) Human Untagged Clone

CAT#: SC330177

APH1A (untagged) - Homo sapiens APH1A gamma secretase subunit (APH1A), transcript variant 3



  "NM_001243771" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Goat Polyclonal Antibody against APH1A
    • 100 ug

CNY 5371.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 6530402N02Rik; APH-1; APH-1A; CGI-78
Vector pCMV6-Entry
Sequence Data
>SC330177 representing NM_001243771.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGGGCTGCGGTGTTTTTCGGCTGCACTTTCGTCGCGTTCGGCCCGGCCTTCGCGCTTTTCTTGATC
ACTGTGGCTGGGGACCCGCTTCGCGTTATCATCCTGGTCGCAGGGAAGGCAGATGAGGGGTTAGCATCG
CTGAGTGAGGACGGAAGATCACCCATCTCCATCCGCCAGATGGCCTATGTTTCTGGTCTCTCCTTCGGT
ATCATCAGTGGTGTCTTCTCTGTTATCAATATTTTGGCTGATGCACTTGGGCCAGGTGTGGTTGGGATC
CATGGAGACTCACCCTATTACTTCCTGACTTCAGCCTTTCTGACAGCAGCCATTATCCTGCTCCATACC
TTTTGGGGAGTTGTGTTCTTTGATGCCTGTGAGAGGAGACGGTACTGGGCTTTGGGCCTGGTGGTTGGG
AGTCACCTACTGACATCGGGACTGACATTCCTGAACCCCTGGTATGAGGCCAGCCTGCTGCCCATCTAT
GCAGTCACTGTTTCCATGGGGCTCTGGGCCTTCATCACAGCTGGAGGGTCCCTCCGAAGTATTCAGCGC
AGCCTCTTGTGTAAGGACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243771
Insert Size 573 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001243771.1
RefSeq Size 2119 bp
RefSeq ORF 573 bp
Locus ID 51107
UniProt ID Q96BI3
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
Protein Pathways Alzheimer's disease, Notch signaling pathway
MW 20.2 kDa
Gene Summary This gene encodes a component of the gamma secretase complex that cleaves integral membrane proteins such as Notch receptors and beta-amyloid precursor protein. The gamma secretase complex contains this gene product, or the paralogous anterior pharynx defective 1 homolog B (APH1B), along with the presenilin, nicastrin, and presenilin enhancer-2 proteins. The precise function of this seven-transmembrane-domain protein is unknown though it is suspected of facilitating the association of nicastrin and presenilin in the gamma secretase complex as well as interacting with substrates of the gamma secretase complex prior to their proteolytic processing. Polymorphisms in a promoter region of this gene have been associated with an increased risk for developing sporadic Alzheimer's disease. Alternative splicing results in multiple protein-coding and non-protein-coding transcript variants. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (3) lacks a 5' exon and contains an alternate segement at the 3'end that results in a frameshift and premature stop codon, compared to variant 1. This variant encodes an isoform (3) with a shorter N-terminus and a shorter and distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...