PPP1R14A (NM_001243947) Human Untagged Clone
CAT#: SC330197
PPP1R14A (untagged) - Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 14A (PPP1R14A), transcript variant 2
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CPI-17; CPI17; PPP1INL |
Vector | pCMV6-Entry |
Sequence Data |
>SC330197 representing NM_001243947.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCAGCTCAGCGGCTGGGCAAGCGCGTGCTGAGCAAGCTGCAGTCTCCATCGCGGGCCCGCGGGCCA GGGGGCAGTCCCGGGGGGCTGCAGAAGCGGCACGCGCGCGTCACCGTCAAGTATGACCGGCGGGAGCTG CAGCGGCGGCTGGACGTGGAGAAGTGGATCGACGGGCGCCTGGAGGAGCTGTACCGCGGCATGGGACTC CTGAAGTCATGTGGGAAACCTGTCGAGGACTTCATCCAGGAGCTGCTGGCAAAGCTTCAAGGCCTCCAC AGGCAGCCCGGCCTCCGCCAGCCAAGCCCCTCCCACGACGGCAGCCTCAGCCCCCTCCAGGACCGGGCC CGGACTGCTCACCCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243947 |
Insert Size | 363 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001243947.1 |
RefSeq Size | 701 bp |
RefSeq ORF | 363 bp |
Locus ID | 94274 |
UniProt ID | Q96A00 |
Protein Families | Druggable Genome |
Protein Pathways | Vascular smooth muscle contraction |
MW | 13.5 kDa |
Gene Summary | The protein encoded by this gene belongs to the protein phosphatase 1 (PP1) inhibitor family. This protein is an inhibitor of smooth muscle myosin phosphatase, and has higher inhibitory activity when phosphorylated. Inhibition of myosin phosphatase leads to increased myosin phosphorylation and enhanced smooth muscle contraction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (2) lacks an in-frame coding exon compared to variant 1. This results in a shorter isoform (2, also known as CPI-17beta) missing an internal protein segment compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231707 | PPP1R14A (Myc-DDK tagged) - Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 14A (PPP1R14A), transcript variant 2 |
CNY 3990.00 |
|
RG231707 | PPP1R14A (tGFP-tagged) - Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 14A (PPP1R14A), transcript variant 2 |
CNY 4370.00 |
其它PPP1R14A产品