HLA-DQB1 (NM_001243962) Human Untagged Clone

CAT#: SC330202

HLA (untagged) - Homo sapiens major histocompatibility complex, class II, DQ beta 1 (HLA-DQB1), transcript variant 3



  "NM_001243962" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
HLA-DQB1 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CELIAC1; HLA-DQB; IDDM1
Vector pCMV6-Entry
Sequence Data
>SC330202 representing NM_001243962.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCTTGGAAAAAGGCTTTGCGGATCCCCGGAGGCCTTCGGGCAGCAACTGTGACCTTGATGCTGTCG
ATGCTGAGCACCCCAGTGGCTGAGGGCAGAGACTCTCCCGAGGATTTCGTGTACCAGTTTAAGGGCATG
TGCTACTTCACCAACGGGACAGAGCGCGTGCGTCTTGTGAGCAGAAGCATCTATAACCGAGAAGAGATC
GTGCGCTTCGACAGCGACGTGGGGGAGTTCCGGGCGGTGACGCTGCTGGGGCTGCCTGCCGCCGAGTAC
TGGAACAGCCAGAAGGACATCCTGGAGAGGAAACGGGCGGCGGTGGACAGGGTGTGCAGACACAACTAC
CAGTTGGAGCTCCGCACGACCTTGCAGCGGCGAGTGGAGCCCACAGTGACCATCTCCCCATCCAGGACA
GAGGCCCTCAACCACCACAACCTGCTGGTCTGCTCGGTGACAGATTTCTATCCAGCCCAGATCAAAGTC
CGGTGGTTTCGGAATGACCAGGAGGAGACAGCTGGCGTTGTGTCCACCCCCCTTATTAGGAATGGTGAC
TGGACCTTCCAGATCCTGGTGATGCTGGAAATGACTCCCCAGCGTGGAGACGTCTACACCTGCCACGTG
GAGCACCCCAGCCTCCAGAGCCCCATCACCGTGGAGTGGCGGGCTCAATCTGAATCTGCCCAGAGCAAG
ATGCTGAGTGGCATTGGAGGCTTCGTGCTGGGGCTGATCTTCCTCGGGCTGGGCCTTATCATCCATCAC
AGGAGTCAGAAAGGGCTCCTGCACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243962
Insert Size 786 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001243962.1
RefSeq Size 1638 bp
RefSeq ORF 786 bp
Locus ID 3119
UniProt ID P01920
Protein Families Transmembrane
Protein Pathways Allograft rejection, Antigen processing and presentation, Asthma, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Graft-versus-host disease, Systemic lupus erythematosus, Type I diabetes mellitus, Viral myocarditis
MW 29.7 kDa
Gene Summary HLA-DQB1 belongs to the HLA class II beta chain paralogs. This class II molecule is a heterodimer consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and it contains six exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DQ molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to four different molecules. Typing for these polymorphisms is routinely done for bone marrow transplantation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (3) has the same exon combination as variant 1 but represents the DQB1*02:01:01:01 allele of the HLA-DQB1 gene, as represented in the alternate locus group ALT_REF_LOCI_2 of the reference genome. It encodes isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...