CSAD (NM_001244706) Human Untagged Clone

CAT#: SC330220

CSAD (untagged) - Homo sapiens cysteine sulfinic acid decarboxylase (CSAD), transcript variant 3



  "NM_001244706" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
CSAD Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CSD; PCAP
Vector pCMV6-Entry
Sequence Data
>SC330220 representing NM_001244706.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGTGCTGTGCCGTTCCTGGTCAGTGCCACCTCTGGCACCACTGTGCTAGGGGCCTTTGACCCCCTG
GAGGCAATTGCTGATGTGTGCCAGCGTCATGGGCTATGGCTGCATGTGGATGCTGCCTGGGGTGGGAGC
GTCCTGCTGTCACAGACACACAGGCATCTCCTGGATGGGATCCAGAGGGCTGACTCTGTGGCCTGGAAT
CCCCACAAGCTCCTCGCAGCAGGCCTGCAATGCTCTGCACTTCTTCTCCAGGATACCTCGAACCTGCTC
AAGCGCTGCCATGGGTCCCAGGCCAGCTACCTTTTCCAGCAGGACAAGTTCTACGATGTGGCTCTGGAC
ACGGGAGACAAGGTGGTGCAGTGTGGCCGCCGTGTGGACTGTCTGAAGCTGTGGCTCATGTGGAAGGCA
CAGGGCGATCAAGGGCTGGAGCGGCGCATCGACCAGGCCTTTGTCCTTGCCCGGTACCTGGTGGAGGAA
ATGAAGAAGCGGGAAGGGTTTGAGCTAGTCATGGAGCCTGAGTTTGTCAATGTGTGTTTCTGGTTCGTA
CCCCCCAGCCTGCGAGGGAAGCAGGAGAGTCCAGATTACCACGAAAGGCTGTCAAAGGTGGCCCCCGTG
CTCAAGGAGCGCATGGTGAAGGAGGGCTCCATGATGATTGGCTACCAGCCCCACGGGACCCGGGGCAAC
TTCTTCCGTGTGGTTGTGGCCAACTCTGCACTGACCTGTGCTGATATGGACTTCCTCCTCAACGAGCTG
GAGCGGCTAGGCCAGGACCTGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001244706
Insert Size 783 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001244706.1
RefSeq Size 1757 bp
RefSeq ORF 783 bp
Locus ID 51380
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Taurine and hypotaurine metabolism
MW 29.2 kDa
Gene Summary This gene encodes a member of the group 2 decarboxylase family. A similar protein in rodents plays a role in multiple biological processes as the rate-limiting enzyme in taurine biosynthesis, catalyzing the decarboxylation of cysteinesulfinate to hypotaurine. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a large portion of the 5' coding region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...