CD64 (FCGR1B) (NM_001244910) Human Untagged Clone
CAT#: SC330230
FCGR1B (untagged) - Homo sapiens Fc fragment of IgG, high affinity Ib, receptor (CD64) (FCGR1B), transcript variant 3
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD64b; FCG1; FcgammaRIa; FCGR1; FCGR1A; FcRI; IGFR1; IGFRB |
Vector | pCMV6-Entry |
Sequence Data |
>SC330230 representing NM_001244910.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTGGTTCTTGACAACTCTGCTCCTTTGGGTTCCAGTTGATGGGCAAGTGGACACCACAAAGGCAGTG ATCACTTTGCAGCCTCCATGGGTCAGCGTGTTCCAAGAGGAAACCGTAACCTTGCACTGTGAGGTGCTC CATCTGCCTGGGAGCAGCTCCACACAGTGGTTTCTCAATGGCACAGCCACTCAGACCTCGACCCCCAGC TACAGAATCACCTCTGCCAGTGTCAATGACAGTGGTGAATACAGGTGCCAGAGAGGTCTCTCAGGGCGA AGTGACCCCATACAGCTGGAAATCCACAGAGGCTGGCTACTACTGCAGGTCTCCAGCAGAGTCTTCATG GAAGGAGAACCTCTGGCCTTGAGGTGTCATGCGTGGAAGGATAAGCTGGTGTACAATGTGCTTTACTAT CGAAATGGCAAAGCCTTTAAGTTTTTCCACTGGAATTCTAACCTCACCATTCTGAAAACCAACATAAGT CACAATGGCACCTACCATTGCTCAGGCATGGGAAAGCATCGCTACACATCAGCAGGAATATCACAATAC ACTGTGAAAGAGCTATTTCCAGCTCCAGTGCTGAATGCATCTGTGACATCCCCACTCCTGGAGGGGAAT CTGGTCACCCTGAGCTGTGAAACAAAGTTGCTCTTGCAGAGGCCTGGTTTGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001244910 |
Insert Size | 675 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001244910.1 |
RefSeq Size | 1581 bp |
RefSeq ORF | 675 bp |
Locus ID | 2210 |
UniProt ID | Q92637 |
Protein Families | Transmembrane |
MW | 25.2 kDa |
Gene Summary | Three distinct, but closely related classes of receptors that bind the Fc portion of IgG have been identified (Fcgamma RI, II and III). The FcgammaRI family consists of three closely related genes termed A, B, and C. This gene likely encodes a non-functional protein that is not detectable at the cell surface and binds ligand with low affinity. [provided by RefSeq, Nov 2019] Transcript Variant: This variant (3) contains an alternate 3' terminal exon compared to variant 1. This results in a shorter isoform (3) with a distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232194 | FCGR1B (Myc-DDK tagged) - Homo sapiens Fc fragment of IgG, high affinity Ib, receptor (CD64) (FCGR1B), transcript variant 3 |
CNY 3990.00 |
|
RG232194 | FCGR1B (tGFP-tagged) - Homo sapiens Fc fragment of IgG, high affinity Ib, receptor (CD64) (FCGR1B), transcript variant 3 |
CNY 4370.00 |