PP1C gamma (PPP1CC) (NM_001244974) Human Untagged Clone

CAT#: SC330239

PPP1CC (untagged) - Homo sapiens protein phosphatase 1, catalytic subunit, gamma isozyme (PPP1CC), transcript variant 2



  "NM_001244974" in other vectors (2)

CNY 3230.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-PPP1CC Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PP-1G; PP1C; PPP1G
Vector pCMV6-Entry
Sequence Data
>SC330239 representing NM_001244974.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGATTTAGATAAACTCAACATCGACAGCATTATCCAACGGCTGCTGGAAGTGAGAGGGTCCAAG
CCTGGTAAGAATGTCCAGCTTCAGGAGAATGAAATCAGAGGACTGTGCTTAAAGTCTCGTGAAATCTTT
CTCAGTCAGCCTATCCTACTAGAACTTGAAGCACCACTCAAAATATGTGGTGACATCCATGGACAATAC
TATGATTTGCTGCGACTTTTTGAGTACGGTGGTTTCCCACCAGAAAGCAACTACCTGTTTCTTGGGGAC
TATGTGGACAGGGGAAAGCAGTCATTGGAGACGATCTGCCTCTTACTGGCCTACAAAATAAAATATCCT
GAGAATTTTTTTCTTCTCAGAGGGAACCATGAATGTGCCAGCATCAACAGAATTTATGGATTTTATGAT
GAATGTAAAAGAAGATACAACATTAAACTATGGAAAACTTTCACAGACTGTTTTAACTGTTTACCGATA
GCAGCCATCGTGGATGAGAAGATATTCTGCTGTCATGGAGGTTTATCACCAGATCTTCAATCTATGGAG
CAGATTCGGCGAATTATGCGACCAACTGATGTACCAGATCAAGGTCTTCTTTGTGATCTTTTGTGGTCT
GACCCCGATAAAGATGTCTTAGGCTGGGGTGAAAATGACAGAGGAGTGTCCTTCACATTTGGTGCAGAA
GTGGTTGCAAAATTTCTCCATAAGCATGATTTGGATCTTATATGTAGAGCCCATCAGGTGGTTGAAGAT
GGATATGAATTTTTTGCAAAGAGGCAGTTGGTCACTCTGTTTTCTGCGCCCAATTATTGCGGAGAGTTT
GACAATGCAGGTGCCATGATGAGTGTGGATGAAACACTAATGTGTTCTTTTCAGATTTTAAAGCCTGCA
GAGAAAAAGAAGCCAAATGCCACGAGACCTGTAACGCCTCCAAGGGTTGCATCAGGCCTGAACCCGTCC
ATTCAGAAAGCTTCAAATTATAGAAACAATACTGTTCTATACGAGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001244974
Insert Size 1014 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001244974.1
RefSeq Size 1626 bp
RefSeq ORF 1014 bp
Locus ID 5501
UniProt ID P36873
Protein Families Druggable Genome, Phosphatase
Protein Pathways Focal adhesion, Insulin signaling pathway, Long-term potentiation, Oocyte meiosis, Regulation of actin cytoskeleton, Vascular smooth muscle contraction
MW 38.5 kDa
Gene Summary The protein encoded by this gene belongs to the protein phosphatase family, PP1 subfamily. PP1 is an ubiquitous serine/threonine phosphatase that regulates many cellular processes, including cell division. It is expressed in mammalian cells as three closely related isoforms, alpha, beta/delta and gamma, which have distinct localization patterns. This gene encodes the gamma isozyme. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (2) differs at the 3' end compared to variant 1. This results in a longer isoform (2) with a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...