NUDT9 (NM_001248011) Human Untagged Clone

CAT#: SC330242

NUDT9 (untagged) - Homo sapiens nudix (nucleoside diphosphate linked moiety X)-type motif 9 (NUDT9), transcript variant 3



  "NM_001248011" in other vectors (2)

CNY 3140.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
NUDT9 mouse monoclonal antibody, clone OTI7A12 (formerly 7A12)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NUDT10
Vector pCMV6-Entry
Sequence Data
>SC330242 representing NM_001248011.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGGACGCCTCCTGGGAAAGGCTTTAGCCGCGGTGTCTCTCTCTCTGGCCTTGGCCTCTGTGACT
ATCAGGTCCTCGCGCTGCCGCGGCATCCAGGCGTTCAGAAACTCGTTTTCATCTTCTTGGTTTCATCTT
AATACCAACGTCATGTCTGGTTCTAATGGTTCCAAAGAAAATTCTCACAATAAGGCTCGGACGTCTCCT
TACCCAGGTTCAAAAGTTGAACGAAGCCAGGTTCCTAATGAGAAAGTGGGCTGGCTTGTTGAGTGGCAA
GACTATAAGCCTGTGGAATACACTGCAGTCTCTGTCTTGGCTGGACCCAGGTGGGCAGATCCTCAGATC
AGAAATCCTGCAGGACGGACTGGACTGGTGGGCCGGGGGCTTTTGGGGCGATGGGGCCCAAATCACGCT
GCAGATCCCATTATAACCAGATGGAAAAGGGATAGCAGTGGAAATAAAATCATGCATCCTGTTTCTGGG
AAGCATATCTTACAATTTGTTGCAATAAAAAGGAAAGACTGTGGAGAATGGGCAATCCCAGGGGGGATG
GTGGATCCAGGAGAGAAGATTAGTGCCACACTGAAAAGAGAATTTGGTGAGGAAGCTCTCAACTCCTTA
CAGAAAACCAGTGCTGAGAAGAGAGAAATAGAGGAAAAGTTGCACAAACTCTTCAGCCAAGACCACCTA
GTGATATATAAGGGATATGTTGATGATCCTCGAAACACTGATAATGCATGGATGGAGACAGAAGCTGTG
AACTACCATGACGAAACAGGTGAGATAATGGATAATCTTATGCTAGAAGCTGGAGATGATGCTGGAAAA
GTGAAATGGGTGGACATCAATGATAAACTGAAGCTTTATGCCAGTCACTCTCAATTCATCAAACTTGTG
GCTGAGAAACGAGATGCACACTGGAGCGAGGACTCTGAAGCTGACTGCCATGCGTTGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001248011
Insert Size 957 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001248011.1
RefSeq Size 2720 bp
RefSeq ORF 957 bp
Locus ID 53343
UniProt ID Q9BW91
Protein Families Druggable Genome, Ion Channels: Other
Protein Pathways Purine metabolism
MW 35.4 kDa
Gene Summary The protein encoded by this gene belongs to the Nudix hydrolase family. Nudix boxes are found in a family of diverse enzymes that catalyze the hydrolysis of nucleoside diphosphate derivatives. This enzyme is an ADP-ribose pyrophosphatase that catalyzes the hydrolysis of ADP-ribose to AMP and ribose-5-P. It requires divalent metal ions and an intact Nudix motif for enzymatic activity. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (3) lacks an in-frame coding exon compared to variant 1. This results in a shorter isoform (c) missing an internal protein segment compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...