SLC9A3R2 (NM_001252073) Human Untagged Clone
CAT#: SC330268
SLC9A3R2 (untagged) - Homo sapiens solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 2 (SLC9A3R2), transcript variant 3
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | E3KARP; NHE3RF2; NHERF-2; NHERF2; OCTS2; SIP-1; SIP1; TKA-1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330268 representing NM_001252073.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCACGCTCCGGGAGTGCCACGCCACCTGCCCGGGCTCCGGGAGCCCCTCCACGGAGCCCACCCCAG AGGCTGGTACAGGATGTCAGTGGGCCCCTGAGGGAGCTGCGCCCTCGGCTCTGCCACCTGCGAAAGGGA CCTCAGGGCTATGGGTTCAACCTGCATAGTGACAAGTCCCGGCCCGGCCAGTACATCCGCTCTGTGGAC CCGGGCTCACCTGCCGCCCGCTCTGGCCTCCGCGCCCAGGACCGGCTCATTGAGGTGAACGGGCAGAAT GTGGAGGGACTGCGCCATGCTGAGGTGGTGGCCAGCATCAAGGCACGGGAGGACGAGGCCCGGCTGCTG GTCGTGGACCCCGAGACAGATGAACACTTCAAGCGGCTTCGGGTCACACCCACCGAGGAGCACGTGGAA GGTCCTCTGCCGTCACCCGTCACCAATGGAACCAGCCCTGCCCAGCTCAATGGTGGCTCTGCGTGCTCG TCCCGAAGTGACCTGCCTGGTTCCGACAAGGACACTGAGGATGGCAGTGCCTGGAAGCAAGATCCCTTC CAGGAGAGCGGCCTCCACCTGAGCCCCACGGCGGCCGAGGCCAAGGAGAAGGCTCGAGCCATGCGAGTC AACAAGCGCGCGCCACAGATGGACTGGAACAGGAAGCGTGAAATCTTCAGCAACTTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001252073 |
Insert Size | 681 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001252073.1 |
RefSeq Size | 1811 bp |
RefSeq ORF | 681 bp |
Locus ID | 9351 |
UniProt ID | Q15599 |
Protein Families | Druggable Genome |
MW | 24.7 kDa |
Gene Summary | This gene encodes a member of the NHERF family of PDZ scaffolding proteins. These proteins mediate many cellular processes by binding to and regulating the membrane expression and protein-protein interactions of membrane receptors and transport proteins. The encoded protein plays a role in intestinal sodium absorption by regulating the activity of the sodium/hydrogen exchanger 3, and may also regulate the cystic fibrosis transmembrane regulator (CFTR) ion channel. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (c) is shorter and has a distinct N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232200 | SLC9A3R2 (Myc-DDK tagged) - Homo sapiens solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 2 (SLC9A3R2), transcript variant 3 |
CNY 3990.00 |
|
RG232200 | SLC9A3R2 (tGFP-tagged) - Homo sapiens solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 2 (SLC9A3R2), transcript variant 3 |
CNY 4370.00 |
其它SLC9A3R2产品