MRAS (NM_001252092) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	M-RAs; NS11; R-RAS3; RRAS3
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC330271 representing NM_001252092. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCGGGAGCAATACATGCGCACGGGGGATGGCTTCCTCATCGTCTACTCCGTCACTGACAAGGCCAGC TTTGAGCACGTGGACCGCTTCCACCAGCTTATCCTGCGCGTCAAAGACAGGGAGTCATTCCCGATGATC CTCGTGGCCAACAAGGTCGATTTGATGCACTTGAGGAAGATCACCAGGGAGCAAGGAAAAGAAATGGCG ACCAAACACAATATTCCGTACATAGAAACCAGTGCCAAGGACCCACCTCTCAATGTCGACAAAGCCTTC CATGACCTCGTTAGAGTAATTAGGCAACAGATTCCGGAAAAAAGCCAGAAGAAGAAGAAGAAAACCAAA TGGCGGGGAGACCGGGCCACAGGCACCCACAAACTGCAATGTGTGATCTTGTGA
Restriction Sites	SgfI-MluI
ACCN	NM_001252092
Insert Size	399 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001252092.1
RefSeq Size	3903 bp
RefSeq ORF	399 bp
Locus ID	22808
UniProt ID	O14807
Protein Families	Druggable Genome
Protein Pathways	MAPK signaling pathway, Regulation of actin cytoskeleton, Tight junction
MW	15.5 kDa
Gene Summary	This gene encodes a member of the Ras family of small GTPases. These membrane-associated proteins function as signal transducers in multiple processes including cell growth and differentiation, and dysregulation of Ras signaling has been associated with many types of cancer. The encoded protein may play a role in the tumor necrosis factor-alpha and MAP kinase signaling pathways. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011] Transcript Variant: This variant (5) differs in the 5' UTR, lacks an exon and uses a downstream, in-frame start codon, compared to variant 1. Variants 4, 5 and 6 encode the same isoform (2), which has a shorter N-terminus compared to isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.