COLEC11 (NM_001255988) Human Untagged Clone

CAT#: SC330341

COLEC11 (untagged) - Homo sapiens collectin sub-family member 11 (COLEC11), transcript variant 9



  "NM_001255988" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit monoclonal anti-COL11 antibody for SISCAPA, clone OTIR1C9
    • 100 ul

CNY 4390.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 3MC2; CL-11; CL-K1-I; CL-K1-II; CL-K1-IIa; CL-K1-IIb; CLK1
Vector pCMV6-Entry
Sequence Data
>SC330341 representing NM_001255988.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTGGTGGGTGCCTCCGAGTCCCTACGGTTGTCTTCCCTGCGCCCTGCCAGGGGATGCGGGAGAGAAG
GGAGACAAAGGCGCCCCCGGACGGCCTGGAAGAGTCGGCCCCACGGGAGAAAAAGGTGAGAAAGGAGAT
TCCGGTGACATAGGACCCCCTGGTCCTAATGGAGAACCAGGCCTCCCATGTGAGTGCAGCCAGCTGCGC
AAGGCCATCGGGGAGATGGACAACCAGGTCTCTCAGCTGACCAGCGAGCTCAAGTTCATCAAGAATGCT
GTCGCCGGTGTGCGCGAGACGGAGAGCAAGATCTACCTGCTGGTGAAGGAGGAGAAGCGCTACGCGGAC
GCCCAGCTGTCCTGCCAGGGCCGCGGGGGCACGCTGAGCATGCCCAAGGACGAGGCTGCCAATGGCCTG
ATGGCCGCATACCTGGCGCAAGCCGGCCTGGCCCGTGTCTTCATCGGCATCAACGACCTGGAGAAGGAG
GGCGCCTTCGTGTACTCTGACCACTCCCCCATGCGGACCTTCAACAAGTGGCGCAGCGGTGAGCCCAAC
AATGCCTACGACGAGGAGGACTGCGTGGAGATGGTGGCCTCGGGCGGCTGGAACGACGTGGCCTGCCAC
ACCACCATGTACTTCATGTGTGAGTTTGACAAGGAGAACATGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001255988
Insert Size 666 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001255988.1
RefSeq Size 1332 bp
RefSeq ORF 666 bp
Locus ID 78989
UniProt ID Q9BWP8
MW 23.9 kDa
Gene Summary This gene encodes a member of the collectin family of C-type lectins that possess collagen-like sequences and carbohydrate recognition domains. Collectins are secreted proteins that play important roles in the innate immune system by binding to carbohydrate antigens on microorganisms, facilitating their recognition and removal. The encoded protein binds to multiple sugars with a preference for fucose and mannose. Mutations in this gene are a cause of 3MC syndrome-2. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (9) differs in the 5' UTR, initiates translation at an alternate start codon, and lacks an exon in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (i) is shorter and has a distinct N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...