Monoacylglycerol Lipase (MGLL) (NM_001256585) Human Untagged Clone

CAT#: SC330462

MGLL (untagged) - Homo sapiens monoglyceride lipase (MGLL), transcript variant 3



  "NM_001256585" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
MGLL (Monoacylglycerol Lipase) mouse monoclonal antibody, clone OTI1H1 (formerly 1H1)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HU-K5; HUK5; MAGL; MGL
Vector pCMV6-Entry
Sequence Data
>SC330462 representing NM_001256585.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAAACAGGACCTGAAGACCCTTCCAGCATGCCAGAGGAAAGTTCCCCCAGGCGGACCCCGCAGAGC
ATTCCCTACCAGGACCTCCCTCACCTGGTCAATGCAGACGGACAGTACCTCTTCTGCAGGTACTGGAAA
CCCACAGGCACACCCAAGGCCCTCATCTTTGTGTCCCATGGAGCCGGAGAGCACAGTGGCCGCTATGAA
GAGCTGGCTCGGATGCTGATGGGGCTGGACCTGCTGGTGTTCGCCCACGACCATGTTGGCCACGGACAG
AGCGAAGGGGAGAGGATGGTAGTGTCTGACTTCCACGTTTTCGTCAGGGATGTGTTGCAGCATGTGGAT
TCCATGCAGAAAGACTACCCTGGGCTTCCTGTCTTCCTTCTGGGCCACTCCATGGGAGGCGCCATCGCC
ATCCTCACGGCCGCAGAGAGGCCGGGCCACTTCGCCGGCATGGTACTCATTTCGCCTCTGGTTCTTGCC
AATCCTGAATCTGCAACAACTTTCAAGGTCGACATTTATAACTCAGACCCCCTGATCTGCCGGGCAGGG
CTGAAGGTGTGCTTCGGCATCCAACTGCTGAATGCCGTCTCACGGGTGGAGCGCGCCCTCCCCAAGCTG
ACTGTGCCCTTCCTGCTGCTCCAGGGCTCTGCCGATCGCCTATGTGACAGCAAAGGGGCCTACCTGCTC
ATGGAGTTAGCCAAGAGCCAGGACAAGACTCTCAAGATTTATGAAGGTGCCTACCATGTTCTCCACAAG
GAGCTTCCTGAAGTCACCAACTCCGTCTTCCATGAAATAAACATGTGGGTCTCTCAAAGGACAGCCACG
GCAGGAACTGCGTCCCCACCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001256585
Insert Size 852 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256585.1
RefSeq Size 4563 bp
RefSeq ORF 852 bp
Locus ID 11343
UniProt ID Q99685
Protein Families Druggable Genome, Protease
Protein Pathways Glycerolipid metabolism, Metabolic pathways
MW 31.1 kDa
Gene Summary This gene encodes a serine hydrolase of the AB hydrolase superfamily that catalyzes the conversion of monoacylglycerides to free fatty acids and glycerol. The encoded protein plays a critical role in several physiological processes including pain and nociperception through hydrolysis of the endocannabinoid 2-arachidonoylglycerol. Expression of this gene may play a role in cancer tumorigenesis and metastasis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (3) lacks an exon in the 3' coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (3) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...