STOML1 (NM_001256673) Human Untagged Clone

CAT#: SC330480

STOML1 (untagged) - Homo sapiens stomatin (EPB72)-like 1 (STOML1), transcript variant 3



  "NM_001256673" in other vectors (2)

CNY 3330.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


STOML1 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms hUNC-24; SLP-1; STORP
Vector pCMV6-Entry
Sequence Data
>SC330480 representing NM_001256673.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCTCGGCAGGTCTGGGTACCGGGCGCTGCCCCTGGGTGATTTTGACCGCTTCCAGCAGTCGAGCTTC
GGCTTTCTGGGCTCGCAGAAGGGCTGCTTGTCCCCGGAGCGGGGCGGCGTGGGGACAGGGGCCGATGTA
CCCCAGAGCTGGCCCTCCTGCCTCTGTCATGGCCTCATCAGTTTCCTGGGGTTCTTGCTGCTGTTGGTC
ACCTTCCCCATTTCTGGCTGGTTTGCCCTGAAGCTGGCCTCTAAGGACGGGGCTGTGCTGTCCGTGGGA
GCCGATGTCCAGTTTCGCATCTGGGACCCGGTGCTGTCGGTGATGACTGTGAAAGACCTGAACACAGCC
ACACGCATGACAGCCCAGAACGCCATGACCAAGGCCCTGCTCAAGAGGCCGCTGCGGGAGATCCAGATG
GAGAAGCTCAAGATCAGCGACCAGCTTCTGCTGGAGATCAACGATGTGACCAGGGCCTGGGGGCTGGAG
GTAGACCGCGTGGAGCTGGCAGTGGAGGCCGTGCTCCAGCCGCCCCAGGACAGCCCAGCTGGGCCCAAC
CTGGACAGCACCCTCCAGCAGCTGGCCCTGCACTTCCTGGGAGGAAGCATGAACTCAATGGCAGGAGGT
GCCCCGTCCCCGGGGCCAGCAGACACCGTGGAGATGGTGAGTGAAGTTGAGCCACCTGCCCCTCAAGTT
GGTGCCAGGTCCAGTCCGAAGCAGCCTCTGGCGGAGGGGCTACTGACTGCTCTACAGCCCTTCCTGTCT
GAGGCCCTGGTCAGCCAAGTCGGGGCCTGCTACCAGTTCAATGTCGTCCTGCCCAGCGGCACCCAAAGC
GCCTACTTCCTGGACCTCACTACAGGACGAGGAAGAGTGGGACACGGGGTGCCTGATGGCATCCCTGAT
GTGGTGGTGGAGATGGCCGAGGCAGACCTGCGGGCCCTGCTATGCAGAGAGCTGCGGCCCCTGGGGGCC
TACATGAGTGGACGGCTGAAGGTGAAGGGCGACCTGGCTATGGCCATGAAGCTGGAGGCTGTCCTCAGG
GCCTTGAAGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001256673
Insert Size 1047 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256673.1
RefSeq Size 1891 bp
RefSeq ORF 1047 bp
Locus ID 9399
UniProt ID Q9UBI4
Protein Families Transmembrane
MW 37.2 kDa
Gene Summary May play a role in cholesterol transfer to late endosomes (PubMed:19696025). May play a role in modulating membrane acid-sensing ion channels. Can specifically inhibit proton-gated current of ASIC1 isoform 1. Can increase inactivation speed of ASIC3. May be involved in regulation of proton sensing in dorsal root ganglions (By similarity). May play a role in protecting FBXW7 isoform 3 from degradation (PubMed:23082202).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks an exon in the coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (3) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...