QTRTD1 (QTRT2) (NM_001256837) Human Untagged Clone

CAT#: SC330531

QTRTD1 (untagged) - Homo sapiens queuine tRNA-ribosyltransferase domain containing 1 (QTRTD1), transcript variant 4



  "NM_001256837" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit polyclonal QTRTD1 Antibody (C-term)
    • 400 ul

CNY 6160.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms QTRTD1
Vector pCMV6-Entry
Sequence Data
>SC330531 representing NM_001256837.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACTGTTTCCAAGTTCATGGCAATTCAGAAGGCCCTTCAGCCAGACTGGTTCCAGTGCCTCTCCGAT
GGAGAAGTATCTTGTAAGGAAGCAACTTCCATAAAAAGGGTCAGAAAGTCTGTTGACCGATCACTTCTT
TTCTTGGATAACTGTCTGCGGCTGCAGGAAGAGTCAGAGGTTCTTCAGAAGAGTGTGATCATTGGAGTG
ATTGAAGGTGGAGATGTGATGGAAGAGAGGCTGAGGTCAGCACGAGAGACAGCCAAGCGGCCTGTGGGT
GGCTTCCTTCTGGATGGTTTTCAAGGAAATCCAACAACCCTGGAGGCTAGACTACGCTTGCTGTCATCA
GTCACTGCAGAGCTGCCGGAGGACAAGCCAAGGCTCATATCTGGTGTTAGTCGGCCAGATGAGGTGCTC
GAGTGTATTGAAAGAGGAGTGGACTTATTTGAGAGTTTTTTCCCTTATCAAGTAACAGAGCGGGGATGT
GCCCTGACTTTCAGTTTTGATTACCAGCCGAATCCTGAAGAGACACTACTACAACAAAATGGAACACAA
GAAGAAATAAAATGTATGGATCAAATAAAGAAAATTGAAACAACTGGTTGCAACCAAGAAATAACATCA
TTTGAAATTAATCTGAAGGAAAAAAAGTACCAGGAGGACTTTAACCCGCTGGTGAGAGGATGTTCCTGT
TACTGCTGTAAGAATCACACTCGGGCATACATCCACCATCTGCTGGTGACCAATGAGCTGCTGGCCGGA
GTCCTGCTTATGATGCACAACTTTGAACACTACTTTGGGTTTTTCCATTACATCCGGGAAGCACTAAAA
AGTGACAAACTGGCACAGTTGAAAGAGCTCATCCACAGGCAAGCATCTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001256837
Insert Size 879 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256837.1
RefSeq Size 3661 bp
RefSeq ORF 879 bp
Locus ID 79691
UniProt ID Q9H974
MW 33.5 kDa
Gene Summary This gene encodes a subunit of tRNA-guanine transglycosylase. tRNA-guanine transglycosylase is a heterodimeric enzyme complex that plays a critical role in tRNA modification by synthesizing the 7-deazaguanosine queuosine, which is found in tRNAs that code for asparagine, aspartic acid, histidine, and tyrosine. The encoded protein may play a role in the queuosine 5'-monophosphate salvage pathway. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (4) lacks two internal exons, uses an alternate splice site and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (4) has a shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...