CD300 antigen (CD300A) (NM_001256841) Human Untagged Clone

CAT#: SC330532

CD300A (untagged) - Homo sapiens CD300a molecule (CD300A), transcript variant 2



  "NM_001256841" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
CD300A Antibody - middle region
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CLM-8; CMRF-35-H9; CMRF-35H; CMRF35-H; CMRF35-H9; CMRF35H; CMRF35H9; IGSF12; IRC1; IRC1/IRC2; IRC2; IRp60
Vector pCMV6-Entry
Sequence Data
>SC330532 representing NM_001256841.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTGGCTGCCTTGGGCTCTGTTGCTTCTCTGGGTCCCAGCATCAACGTCAATGACACCTGCAAGTATC
ACTGCGGCCAAGACCTCAACAATCACAACTGCATTTCCACCTGTATCATCCACTACCCTGTTTGCAGTG
GGTGCCACCCACAGTGCCAGCATCCAGGAGGAAACTGAGGAGGTGGTGAACTCACAGCTCCCGCTGCTC
CTCTCCCTGCTGGCATTGTTGCTGCTTCTGTTGGTGGGGGCCTCCCTGCTAGCCTGGAGGATGTTTCAG
AAATGGATCAAAGCTGGTGACCATTCAGAGCTGTCCCAGAACCCCAAGCAGGCTGCCACGCAGAGTGAG
CTGCACTACGCAAATCTGGAGCTGCTGATGTGGCCTCTGCAGGAAAAGCCAGCACCACCAAGGGAGGTG
GAGGTGGAATACAGCACTGTGGCCTCCCCCAGGGAAGAACTTCACTATGCCTCGGTGGTGTTTGATTCT
AACACCAACAGGATAGCTGCTCAGAGGCCTCGGGAGGAGGAACCAGATTCAGATTACAGTGTGATAAGG
AAGACATAG

Restriction Sites SgfI-MluI     
ACCN NM_001256841
Insert Size 561 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256841.1
RefSeq Size 1554 bp
RefSeq ORF 561 bp
Locus ID 11314
UniProt ID Q9UGN4
Protein Families Transmembrane
MW 20.6 kDa
Gene Summary This gene encodes a member of the CD300 glycoprotein family of cell surface proteins found on leukocytes involved in immune response signaling pathways. This gene is located on chromosome 17 in a cluster with all but one of the other family members. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (2) lacks an exon in the 5' coding region compared to variant 1. The resulting protein (isoform 2), also referred to as IRC1c, is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...