LIF (NM_001257135) Human Untagged Clone
CAT#: SC330571
LIF (untagged) - Homo sapiens leukemia inhibitory factor (LIF), transcript variant 2
CNY 2950.00
货期*
4周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CDF; DIA; HILDA; MLPLI |
Vector | pCMV6-Entry |
Sequence Data |
>SC330571 representing NM_001257135.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAAGGTCTTGGCGGCAGTACACAGCCCAGGGGGAGCCGTTCCCCAACAACCTGGACAAGCTATGTGG CCCCAACGTGACGGACTTCCCGCCCTTCCACGCCAACGGCACGGAGAAGGCCAAGCTGGTGGAGCTGTA CCGCATAGTCGTGTACCTTGGCACCTCCCTGGGCAACATCACCCGGGACCAGAAGATCCTCAACCCCAG TGCCCTCAGCCTCCACAGCAAGCTCAACGCCACCGCCGACATCCTGCGAGGCCTCCTTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001257135 |
Insert Size | 267 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001257135.1 |
RefSeq Size | 3808 bp |
RefSeq ORF | 267 bp |
Locus ID | 3976 |
UniProt ID | P15018 |
Protein Families | Adult stem cells, Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein |
Protein Pathways | Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway |
MW | 9.6 kDa |
Gene Summary | The protein encoded by this gene is a pleiotropic cytokine with roles in several different systems. It is involved in the induction of hematopoietic differentiation in normal and myeloid leukemia cells, induction of neuronal cell differentiation, regulator of mesenchymal to epithelial conversion during kidney development, and may also have a role in immune tolerance at the maternal-fetal interface. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012] Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...