FE65 (APBB1) (NM_001257324) Human Untagged Clone
CAT#: SC330601
APBB1 (untagged) - Homo sapiens amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65) (APBB1), transcript variant 3
CNY 2950.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FE65; MGC:9072; RIR |
Vector | pCMV6-Entry |
Sequence Data |
>SC330601 representing NM_001257324.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAGGGTCCAGGACACCTCAGGGACCTATTACTGGCACATCCCAACAGGGACCACCCAGTGGGAACCC CCCGGCCGGGCCTCCCCCTCACAGGGGAGCAGCCCCCAAGAGGAGTCCCAGCTCACCTGGACAGGTTTT GCTCATGGAGAAGGCTTTGAGGATGGAGAATTTTGGAAGGATGAACCCAGTGATGAGGCCCCAATGGAG CTGGGACTGAAGGAACCTGAGGAGGGGACGTTGACCTTCCCAGCTCAGAGCCTCAGCCCAGAGCCGTTG CCCCAAGAGGAGGAGAAGCTTCCCCCACGGAATACCAACCCAGGGATCAAGTGTTTCGCCGTGCGCTCC CTAGGCTGGGTAGAGATGACCGAGGAGGAGCTGGCCCCTGGACGCAGCAGTGTGGCAGTCAACAATTGC ATCCGTCAGCTCTCTTACCACAAAAACAACCTGCATGACCCCATGTCTGGGGGCTGGGGGGAAGGAAAG GATCTGCTACTGCAGCTGGAGGATGAGACACTAAAGCTAGTGGAGCCACAGAGCCAGGCACTGCTGCAC GCCCAACCCATCATCAGCATCCGCGTGTGGGGCGTCGGGCGGGACAGTGGAAGAGAGAGGGACTTTGCC TACGTAGCTCGTGATAAGCTGACCCAGATGCTCAAGTGCCACGTGTTTCGCTGTGAGGCACCTGCCAAG AACATCGCCACCAGCCTGCATGAGATCTGCTCTAAGGCACGGCCCCCTCCACTCCCTGGACTAGTTGCC ACCTTTGCTCTACAAGGGTGTGGGTGGGGTCACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001257324 |
Insert Size | 795 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001257324.1 |
RefSeq Size | 1422 bp |
RefSeq ORF | 795 bp |
Locus ID | 322 |
Protein Families | Transcription Factors |
Protein Pathways | Alzheimer's disease |
MW | 29.3 kDa |
Gene Summary | The protein encoded by this gene is a member of the Fe65 protein family. It is an adaptor protein localized in the nucleus. It interacts with the Alzheimer's disease amyloid precursor protein (APP), transcription factor CP2/LSF/LBP1 and the low-density lipoprotein receptor-related protein. APP functions as a cytosolic anchoring site that can prevent the gene product's nuclear translocation. This encoded protein could play an important role in the pathogenesis of Alzheimer's disease. It is thought to regulate transcription. Also it is observed to block cell cycle progression by downregulating thymidylate synthase expression. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012] Transcript Variant: This variant (3) lacks the second exon, lacks several 3' exons, and its 3' end extends across some introns compared to variant 1. The resulting isoform (c) is shorter at the N-terminus and has a shorter and distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232326 | APBB1 (Myc-DDK tagged) - Homo sapiens amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65) (APBB1), transcript variant 3 |
CNY 3990.00 |
|
RG232326 | APBB1 (tGFP-tagged) - Homo sapiens amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65) (APBB1), transcript variant 3 |
CNY 4370.00 |