GALT (NM_001258332) Human Untagged Clone

CAT#: SC330663

GALT (untagged) - Homo sapiens galactose-1-phosphate uridylyltransferase (GALT), transcript variant 2



  "NM_001258332" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-GALT Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC330663 representing NM_001258332.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACCCTCTCAACCCTCTGTGTCCTGGGGCCATCCGAGCCAACGGAGAGTAAGGTCATGTGCTTCCAC
CCCTGGTCGGATGTAACGCTGCCACTCATGTCGGTCCCTGAGATCCGGGCTGTTGTTGATGCATGGGCC
TCAGTCACAGAGGAGCTGGGTGCCCAGTACCCTTGGGTGCAGATCTTTGAAAACAAAGGTGCCATGATG
GGCTGTTCTAACCCCCACCCCCACTGCCAGGTATGGGCCAGCAGTTTCCTGCCAGATATTGCCCAGCGT
GAGGAGCGATCTCAGCAGGCCTATAAGAGTCAGCATGGAGAGCCCCTGCTAATGGAGTACAGCCGCCAG
GAGCTACTCAGGAAGGAACGTCTGGTCCTAACCAGTGAGCACTGGTTAGTACTGGTCCCCTTCTGGGCA
ACATGGCCCTACCAGACACTGCTGCTGCCCCGTCGGCATGTGCGGCGGCTACCTGAGCTGACCCCTGCT
GAGCGTGATGATCTAGCCTCCATCATGAAGAAGCTCTTGACCAAGTATGACAACCTCTTTGAGACGTCC
TTTCCCTACTCCATGGGCTGGCATGGGGCTCCCACAGGATCAGAGGCTGGGGCCAACTGGAACCATTGG
CAGCTGCACGCTCATTACTACCCTCCGCTCCTGCGCTCTGCCACTGTCCGGAAATTCATGGTTGGCTAC
GAAATGCTTGCTCAGGCTCAGAGGGACCTCACCCCTGAGCAGGCTGCAGAGAGACTAAGGGCACTTCCT
GAGGTTCATTACCACCTGGGGCAGAAGGACAGGGAGACAGCAACCATCGCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001258332
Insert Size 813 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001258332.1
RefSeq Size 1282 bp
RefSeq ORF 813 bp
Locus ID 2592
UniProt ID P07902
Protein Families Druggable Genome
Protein Pathways Amino sugar and nucleotide sugar metabolism, Galactose metabolism, Metabolic pathways
MW 31.1 kDa
Gene Summary Galactose-1-phosphate uridyl transferase (GALT) catalyzes the second step of the Leloir pathway of galactose metabolism, namely the conversion of UDP-glucose + galactose-1-phosphate to glucose-1-phosphate + UDP-galactose. The absence of this enzyme results in classic galactosemia in humans and can be fatal in the newborn period if lactose is not removed from the diet. The pathophysiology of galactosemia has not been clearly defined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Transcript Variant: This variant (2) lacks two alternate coding exons compared to variant 1, that causes a frameshift. The resulting isoform (2) has a shorter and distinct N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...