SRP68 (NM_001260503) Human Untagged Clone

CAT#: SC330690

SRP68 (untagged) - Homo sapiens signal recognition particle 68kDa (SRP68), transcript variant 3



  "NM_001260503" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-SRP68 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC330690 representing NM_001260503.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCTCAGCGAGTGTCGGGACGCCATCCAGGTGGTTCGGGAGGAGCTCAAGCCAGATCAGAAACAGAGA
GATTATATCCTTGAAGGAGAGCCAGGGAAGGTGTCTAATCTTCAATACTTGCATAGCTACCTGACTTAC
ATCAAGCTATCAACGGCAATCAAGCGTAATGAGAACATGGCCAAAGGTCTGCAGAGGGCTCTGCTGCAG
CAGCAGCCAGAGGATGACAGCAAGCGCTCACCCCGGCCCCAGGACCTGATCCGACTCTATGACATCATC
TTACAGAATCTGGTGGAATTGCTCCAGCTTCCTGGTTTAGAGGAAGACAAAGCCTTCCAGAAAGAGATA
GGCCTCAAGACTCTGGTGTTCAAAGCTTACAGGTGTTTTTTCATTGCTCAGTCCTATGTGCTGGTGAAG
AAGTGGAGCGAAGCCCTTGTCCTGTATGACAGAGTCCTGAAATATGCAAATGAAGTAAATTCTGATGCT
GGCGCCTTCAAGAACAGCCTAAAGGACCTGCCTGATGTGCAAGAGCTCATCACTCAAGTGCGGTCAGAG
AAGTGCTCCCTGCAGGCCGCAGCCATCCTTGATGCAAACGACGCTCATCAAACAGAGACCTCCTCCTCC
CAAGTCAAGGACAATAAGCCTCTGGTTGAACGGTTTGAGACATTCTGCCTGGACCCTTCCCTTGTCACC
AAGCAAGCCAACCTTGTGCACTTCCCACCAGGCTTCCAGCCCATTCCCTGCAAGCCTTTGTTCTTTGAC
CTGGCCCTCAACCATGTGGCTTTCCCACCCCTTGAGGACAAGTTGGAACAGAAGACCAAGAGTGGCCTC
ACTGGATACATCAAGGGCATCTTTGGATTCAGGAGCTAA

Restriction Sites SgfI-MluI     
ACCN NM_001260503
Insert Size 867 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001260503.1
RefSeq Size 2045 bp
RefSeq ORF 867 bp
Locus ID 6730
UniProt ID Q9UHB9
Protein Pathways Protein export
MW 32.9 kDa
Gene Summary This gene encodes a subunit of the signal recognition particle (SRP). The SRP is a ribonucleoprotein complex that transports secreted and membrane proteins to the endoplasmic reticulum for processing. The complex includes a 7S RNA and six protein subunits. The encoded protein is the 68kDa component of the SRP, and forms a heterodimer with the 72kDa subunit that is required for SRP function. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and three pseudogenes of this gene are located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, May 2012]
Transcript Variant: This variant (3) lacks a large portion of the 5' coding region, uses an alternate 5'-most exon and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...