TXNRD1 (NM_001261446) Human Untagged Clone

CAT#: SC330714

TXNRD1 (untagged) - Homo sapiens thioredoxin reductase 1 (TXNRD1), transcript variant 7



  "NM_001261446" in other vectors (2)

CNY 4470.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TXNRD1 mouse monoclonal antibody,clone OTI7B2
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GRIM-12; TR; TR1; TRXR1; TXNR
Vector pCMV6-Entry
Sequence Data
>SC330714 representing NM_001261446.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTCCTGGACTTTGTCACTCCCACCCCTCTTGGAACTAGATGGGGTCTCGGAGGAACATGTGTGAAT
GTGGGTTGCATACCTAAAAAACTGATGCATCAAGCAGCTTTGTTAGGACAAGCCCTGCAAGACTCTCGA
AATTATGGATGGAAAGTCGAGGAGACAGTTAAGCATGATTGGGACAGAATGATAGAAGCTGTACAGAAT
CACATTGGCTCTTTGAATTGGGGCTACCGAGTAGCTCTGCGGGAGAAAAAAGTCGTCTATGAGAATGCT
TATGGGCAATTTATTGGTCCTCACAGGATTAAGGCAACAAATAATAAAGGCAAAGAAAAAATTTATTCA
GCAGAGAGATTTCTCATTGCCACTGGTGAAAGACCACGTTACTTGGGCATCCCTGGTGACAAAGAATAC
TGCATCAGCAGTGATGATCTTTTCTCCTTGCCTTACTGCCCGGGTAAGACCCTGGTTGTTGGAGCATCC
TATGTCGCTTTGGAGTGCGCTGGATTTCTTGCTGGTATTGGTTTAGACGTCACTGTTATGGTTAGGTCC
ATTCTTCTTAGAGGATTTGACCAGGACATGGCCAACAAAATTGGTGAACACATGGAAGAACATGGCATC
AAGTTTATAAGACAGTTCGTACCAATTAAAGTTGAACAAATTGAAGCAGGGACACCAGGCCGACTCAGA
GTAGTAGCTCAGTCCACCAATAGTGAGGAAATCATTGAAGGAGAATATAATACGGTGATGCTGGCAATA
GGAAGAGATGCTTGCACAAGAAAAATTGGCTTAGAAACCGTAGGGGTGAAGATAAATGAAAAGACTGGA
AAAATACCTGTCACAGATGAAGAACAGACCAATGTGCCTTACATCTATGCCATTGGCGATATATTGGAG
GATAAGGTGGAGCTCACCCCAGTTGCAATCCAGGCAGGAAGATTGCTGGCTCAGAGGCTCTATGCAGGT
TCCACTGTCAAGTGTGACTATGAAAATGTTCCAACCACTGTATTTACTCCTTTGGAATATGGTGCTTGT
GGCCTTTCTGAGGAGAAAGCTGTGGAGAAGTTTGGGGAAGAAAATATTGAGGTTTACCATAGTTACTTT
TGGCCATTGGAATGGACGATTCCGTCAAGAGATAACAACAAATGTTATGCAAAAATAATCTGTAATACT
AAAGACAATGAACGTGTTGTGGGCTTTCACGTACTGGGTCCAAATGCTGGAGAAGTTACACAAGGCTTT
GCAGCTGCGCTCAAATGTGGACTGACCAAAAAGCAGCTGGACAGCACAATTGGAATCCACCCTGTCTGT
GCAGAGGTATTCACAACATTGTCTGTGACCAAGCGCTCTGGGGCAAGCATCCTCCAGGCTGGCTGCTGA
GGTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001261446
Insert Size 1386 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001261446.1
RefSeq Size 3846 bp
RefSeq ORF 1386 bp
Locus ID 7296
UniProt ID Q16881
Protein Families Druggable Genome
Protein Pathways Pyrimidine metabolism
MW 50.8 kDa
Gene Summary The protein encoded by this gene belongs to the pyridine nucleotide-disulfide oxidoreductase family, and is a member of the thioredoxin (Trx) system. Three thioredoxin reductase (TrxR) isozymes are found in mammals. TrxRs are selenocysteine-containing flavoenzymes, which reduce thioredoxins, as well as other substrates, and play a key role in redox homoeostasis. This gene encodes an ubiquitously expressed, cytosolic form of TrxR, which functions as a homodimer containing FAD, and selenocysteine (Sec) at the active site. Sec is encoded by UGA codon that normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, the Sec insertion sequence (SECIS) element, which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. Alternative splicing, primarily at the 5' end, results in transcript variants encoding same or different isoforms, including a glutaredoxin-containing isoform that is predominantly expressed in testis. [provided by RefSeq, May 2017]
Transcript Variant: This variant (6) lacks an internal exon in the 5' region, which results in translation initiation from an in-frame downstream start codon compared to variant 1. The encoded isoform (4) has a shorter N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...