URM1 (NM_001265582) Human Untagged Clone
CAT#: SC330735
URM1 (untagged) - Homo sapiens ubiquitin related modifier 1 (URM1), transcript variant 3
CNY 2950.00
货期*
4周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C9orf74 |
Vector | pCMV6-Entry |
Sequence Data |
>SC330735 representing NM_001265582.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCTGCGCCCTTGTCAGTGGAGGTGGAGTTCGGAGGTGGTGCGGAGCTCCTGTTTGACGGTATTAAG AAACATCGAGTCACTTTGCCTGGACAGGAGGAACCCTGGGACATCCGGAACCTGCTCATCTGGATCAAG AAGAATTTGCTAAAAGAGCGGCCAGAGTTGTTCATCCAGGGAGACAGCGTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001265582 |
Insert Size | 192 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001265582.1 |
RefSeq Size | 4369 bp |
RefSeq ORF | 192 bp |
Locus ID | 81605 |
UniProt ID | Q9BTM9 |
MW | 7.1 kDa |
Gene Summary | Acts as a sulfur carrier required for 2-thiolation of mcm(5)S(2)U at tRNA wobble positions of cytosolic tRNA(Lys), tRNA(Glu) and tRNA(Gln). Serves as sulfur donor in tRNA 2-thiolation reaction by being thiocarboxylated (-COSH) at its C-terminus by MOCS3. The sulfur is then transferred to tRNA to form 2-thiolation of mcm(5)S(2)U. Also acts as a ubiquitin-like protein (UBL) that is covalently conjugated via an isopeptide bond to lysine residues of target proteins such as MOCS3, ATPBD3, CTU2, USP15 and CAS. The thiocarboxylated form serves as substrate for conjugation and oxidative stress specifically induces the formation of UBL-protein conjugates.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) has an additional segment in the 3' end, compared to variant 2, which reults in a protein (isoform C) with a shorter C-terminus, compared to isoform B. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...