Caspase-7 (CASP7) (NM_001267056) Human Untagged Clone

CAT#: SC330751

CASP7 (untagged) - Homo sapiens caspase 7, apoptosis-related cysteine peptidase (CASP7), transcript variant e



  "NM_001267056" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Caspase 7 Antibody
    • 100 ug

CNY 5302.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CASP-7; CMH-1; ICE-LAP3; LICE2; MCH3
Vector pCMV6-Entry
Sequence Data
>SC330751 representing NM_001267056.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCAGATGATCAGGGCTGTATTGAAGAGCAGGGGGTTGAGGATTCAGCAAATGAAGATTCAGTGGAT
GCTAAGCCAGACCGGTCCTCGTTTGTACCGTCCCTCTTCAGTAAGAAGAAGAAAAATGTCACCATGCGA
TCCATCAAGACCACCCGGGACCGAGTGCCTACATATCAGTACAACATGAATTTTGAAAAGCTGGGCAAA
TGCATCATAATAAACAACAAGAACTTTGATAAAGTGACAGGTATGGGCGTTCGAAACGGAACAGACAAA
GATGCCGAGGCGCTCTTCAAGTGCTTCCGAAGCCTGGGTTTTGACGTGATTGTCTATAATGACTGCTCT
TGTGCCAAGATGCAAGATCTGCTTAAAAAAGCTTCTGAAGAGGACCATACAAATGCCGCCTGCTTCGCC
TGCATCCTCTTAAGCCATGGAGAAGAAAATGTAATTTATGGGAAAGATGGTGTCACACCAATAAAGGAT
TTGACAGCCCACTTTAGGGGGGATAGATGCAAAACCCTTTTAGAGAAACCCAAACTCTTCTTCATTCAG
GCTTGCCGAGGGACCGAGCTTGATGATGGCATCCAGGCCGACTCGGGGCCCATCAATGACACAGATGCT
AATCCTCGATACAAGATCCCAGTGGAAGCTGACTTCCTCTTCGCCTATTCCACGGTTCCAGGCTATTAC
TCGTGGAGGAGCCCAGGAAGAGGCTCCTGGTTTGTGCAAGCCCTCTGCTCCATCCTGGAGGAGCACGGA
AAAGACCTGGAAATCATGCAGATCCTCACCAGGGTGAATGACAGAGTTGCCAGGCACTTTGAGTCTCAG
TCTGATGACCCACACTTCCATGAGAAGAAGCAGATCCCCTGTGTGGTCTCCATGCTCACCAAGGAACTC
TACTTCAGTCAATAG

Restriction Sites SgfI-MluI     
ACCN NM_001267056
Insert Size 912 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001267056.1
RefSeq Size 2485 bp
RefSeq ORF 912 bp
Locus ID 840
UniProt ID P55210
Protein Families Druggable Genome, Protease
Protein Pathways Alzheimer's disease, Apoptosis
MW 34.3 kDa
Gene Summary This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. The precursor of the encoded protein is cleaved by caspase 3 and 10, is activated upon cell death stimuli and induces apoptosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
Transcript Variant: This variant (e) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream, in-frame start codon, compared to variant d. Variants a, c and e encode the same isoform (alpha), which has a shorter N-terminus compared to isoform delta.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...