CREM (NM_001267570) Human Untagged Clone
CAT#: SC330764
CREM (untagged) - Homo sapiens cAMP responsive element modulator (CREM), transcript variant 31
CNY 2950.00
货期*
4周
规格
Product images

推荐一起购买 (4)
CREM mouse monoclonal antibody,clone OTI7A2
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CREM-2; hCREM-2; ICER |
Vector | pCMV6-Entry |
Sequence Data |
>SC330764 representing NM_001267570.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAACAGAACTCAGGAGTTGTCTGGCCAGCTTAGTGATGAGGAAACTGAACTTGCCCCAAGTCACATG GCTGCTGCCACTGGTGACATGCCAACTTACCAGATCCGAGCTCCTACTGCTGCTTTGCCACAGGGAGTG GTGATGGCTGCATCGCCCGGAAGTTTGCACAGTCCCCAGCAGCTGGCAGAAGAAGCAACACGCAAACGA GAGCTGAGGCTAATGAAAAACAGGGAAGCTGCCAAAGAATGTCGACGTCGAAAGAAAGAATATGTAAAA TGTCTGGAGAGCCGAGTTGCAGTGCTGGAAGTCCAGAACAAGAAGCTTATAGAGGAACTTGAAACCTTG AAAGACATTTGTTCTCCCAAAACAGATTACTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001267570 |
Insert Size | 378 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001267570.1 |
RefSeq Size | 1699 bp |
RefSeq ORF | 378 bp |
Locus ID | 1390 |
UniProt ID | Q03060 |
Protein Families | Druggable Genome, Transcription Factors |
MW | 14 kDa |
Gene Summary | This gene encodes a bZIP transcription factor that binds to the cAMP responsive element found in many viral and cellular promoters. It is an important component of cAMP-mediated signal transduction during the spermatogenetic cycle, as well as other complex processes. Alternative promoter and translation initiation site usage allows this gene to exert spatial and temporal specificity to cAMP responsiveness. Multiple alternatively spliced transcript variants encoding several different isoforms have been found for this gene, with some of them functioning as activators and some as repressors of transcription. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (31) has two alternate exons in place of the first six exons compared to variant 1. The resulting isoform (31) has a shorter and distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...