GPR161 (NM_001267614) Human Untagged Clone

CAT#: SC330772

GPR161 (untagged) - Homo sapiens G protein-coupled receptor 161 (GPR161), transcript variant 7



  "NM_001267614" in other vectors (2)

CNY 3900.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-GPR161 Antibody
    • 50 ug

CNY 4628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms RE2
Vector pCMV6-Entry
Sequence Data
>SC330772 representing NM_001267614.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCTCGTGCCCGTCGGCTGGATGAATGAAAGCTACTATGCTGTCCTGTACCCCATGGTGTACCCCATG
AAGATCACAGGGAACCGGGCTGTGATGGCACTTGTCTACATCTGGCTTCACTCGCTCATCGGCTGCCTG
CCACCCCTGTTTGGTTGGTCATCCGTGGAGTTTGACGAGTTCAAATGGATGTGTGTGGCTGCTTGGCAC
CGGGAGCCTGGCTACACGGCCTTCTGGCAGATCTGGTGTGCCCTCTTCCCCTTTCTGGTCATGCTGGTG
TGCTATGGCTTCATCTTCCGCGTGGCCAGGGTCAAGGCACGCAAGGTGCACTGTGGCACAGTCGTCATC
GTGGAGGAGGATGCTCAGAGGACCGGGAGGAAGAACTCCAGCACCTCCACCTCCTCTTCAGGCAGCAGG
AGGAATGCCTTTCAGGGTGTGGTCTACTCGGCCAACCAGTGCAAAGCCCTCATCACCATCCTGGTGGTC
CTCGGTGCCTTCATGGTCACCTGGGGCCCCTACATGGTTGTCATCGCCTCTGAGGCCCTCTGGGGGAAA
AGCTCCGTCTCCCCGAGCCTGGAGACTTGGGCCACATGGCTGTCCTTTGCCAGCGCTGTCTGCCACCCC
CTGATCTATGGACTCTGGAACAAGACAGTTCGCAAAGAACTACTGGGCATGTGCTTTGGGGACCGGTAT
TATCGGGAACCATTTGTGCAACGACAGAGGACTTCCAGGCTCTTCAGCATTTCCAACAGGATCACAGAC
CTGGGCCTGTCCCCACACCTCACTGCGCTCATGGCAGGTGGACAGCCCCTGGGGCACAGCAGCAGCACG
GGGGACACTGGCTTCAGCTGCTCCCAGGACTCAGGGACAGATATGATGCTGCTTGAGGACTACACGTCT
GATGACAACCCTCCCTCTCACTGCACTTGCCCACCCAAGAGAAGGAGCTCGGTGACATTTGAGGATGAA
GTGGAACAAATCAAAGAAGCTGCCAAGAACTCGATTCTTCATGTGAAAGCTGAAGTACACAAGTCCTTG
GACAGTTACGCAGCAAGCTTGGCCAAAGCCATTGAGGCCGAAGCCAAAATCAACTTATTTGGGGAGGAG
GCTTTGCCAGGGGTCTTGGTTACAGCACGGACTGTCCCGGGGGGCGGCTTCGGGGGCCGCCGAGGCAGC
AGAACTCTTGTGAGCCAGAGGCTGCAGTTGCAGAGCATCGAAGAAGGAGATGTTTTAGCTGCCGAGCAG
AGATGA

Restriction Sites SgfI-MluI     
ACCN NM_001267614
Insert Size 1248 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001267614.1
RefSeq Size 7397 bp
RefSeq ORF 1248 bp
Locus ID 23432
UniProt ID Q8N6U8
Protein Families Druggable Genome, GPCR, Transmembrane
MW 46 kDa
Gene Summary The protein encoded by this gene is an orphan G protein-coupled receptor whose ligand is unknown. This gene is overexpressed in triple-negative breast cancer, and disruption of this gene slows the proliferation of basal breast cancer cells. Therefore, this gene is a potential drug target for triple-negative breast cancer. [provided by RefSeq, Mar 2017]
Transcript Variant: This variant (7) lacks a portion of the 5' coding region, initiates translation at an upstream start codon and lacks an alternate in-frame exon compared to variant 1. The resulting isoform (6) is shorter and has a distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...