CD16b (FCGR3B) (NM_001271037) Human Untagged Clone
CAT#: SC330920
FCGR3B (untagged) - Homo sapiens Fc fragment of IgG, low affinity IIIb, receptor (CD16b) (FCGR3B), transcript variant 5
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD16; CD16A; CD16b; FCG3; FCGR3; FCGR3A; FCR-10; FCRIII; FCRIIIb |
Vector | pCMV6-Entry |
Sequence Data |
>SC330920 representing NM_001271037.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCGGACTGAAGATCTCCCAAAGGCTGTGGTGTTCCTGGAGCCTCAATGGTACAGCGTGCTTGAGAAG GACAGTGTGACTCTGAAGTGCCAGGGAGCCTACTCCCCTGAGGACAATTCCACACAGTGGTTTCACAAT GAGAACCTCATCTCAAGCCAGGCCTCGAGCTACTTCATTGACGCTGCCACAGTCAACGACAGTGGAGAG TACAGGTGCCAGACAAACCTCTCCACCCTCAGTGACCCGGTGCAGCTAGAAGTCCATATCGGTTTGGCA GTGTCAACCATCTCATCATTCTCTCCACCTGGGTACCAAGTCTCTTTCTGCTTGGTGATGGTACTCCTT TTTGCAGTGGACACAGGACTATATTTCTCTGTGAAGACAAACATTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271037 |
Insert Size | 393 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001271037.1 |
RefSeq Size | 2002 bp |
RefSeq ORF | 393 bp |
Locus ID | 2215 |
UniProt ID | O75015 |
Protein Families | ES Cell Differentiation/IPS, Secreted Protein, Transmembrane |
Protein Pathways | Natural killer cell mediated cytotoxicity, Systemic lupus erythematosus |
MW | 14.4 kDa |
Gene Summary | The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1. [provided by RefSeq, Aug 2012] Transcript Variant: This variant (5) differs in the 5' UTR and coding sequence and lacks an alternate in-frame exon compared to variant 1. The resulting isoform (5) is shorter at the N-terminus and lacks an alternate internal segment compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231751 | FCGR3B (Myc-DDK tagged) - Homo sapiens Fc fragment of IgG, low affinity IIIb, receptor (CD16b) (FCGR3B), transcript variant 5 |
CNY 1320.00 |
|
RG231751 | FCGR3B (tGFP-tagged) - Homo sapiens Fc fragment of IgG, low affinity IIIb, receptor (CD16b) (FCGR3B), transcript variant 5 |
CNY 2920.00 |