GTF2H3 (NM_001271866) Human Untagged Clone
CAT#: SC330986
GTF2H3 (untagged) - Homo sapiens general transcription factor IIH, polypeptide 3, 34kDa (GTF2H3), transcript variant 2
CNY 2950.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BTF2; P34; TFB4; TFIIH |
Vector | pCMV6-Entry |
Sequence Data |
>SC330986 representing NM_001271866.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGTTTCAGACGAAGATGAATTGAATCTTCTGGTTATTGTAGTTGATGCCAACCCAATTTGGTGGGGA AAGCAAGCATTAAAGGAATCTCAGTTCACTTTATCCAAATGCATAGATGCCGTGATGGTGCTGGGAAAT TCGCATTTATTCATGAATCGTTCCAACAAACTTGCTGTGATAGCAAGTCACATTCAAGAAAGCCGATTC TTATATCCTGGAAAGAATGGCAGACTTGGAGACTTCTTCGGAGACCCTGGCAACCCTCCTGAATTTAAT CCCTCTGGGAGTAAAGATGGAAAATACGAACTTTTAACCTCAGCAAATGAAGTTATTGTTGAAGAGATT AAAGATCTAATGACCAAAAGTGACATAAAGGGTCAACATACAGAAACTTTGCTGGCAGGATCCCTGGCC AAAGCCCTTTGCTACATTCATAGAATGAACAAGGAAGTTAAAGACAATCAGGAAATGAAATCAAGGATA TTGGCTTGTGACATCACGGGAGGACTGTACCTGAAGGTGCCTCAGATGCCTTCTCTTCTGCAGTATTTG CTGTGGGTGTTTCTTCCCGATCAAGATCAGAGATCTCAGTTAATCCTCCCACCCCCAGTTCATGTTGAC TACAGGGCTGCTTGCTTCTGTCATCGAAATCTCATTGAAATTGGTTATGTCTGTTCTGTGTGTTTGTCA ATATTCTGCAATTTCAGCCCCATTTGTACTACGTGCGAGACAGCCTTTAAAATTTCTCTGCCTCCAGTG CTGAAAGCCAAGAAAAAGAAACTGAAAGTGTCTGCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001271866 |
Insert Size | 798 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001271866.1 |
RefSeq Size | 3305 bp |
RefSeq ORF | 798 bp |
Locus ID | 2967 |
UniProt ID | Q13889 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Basal transcription factors, Nucleotide excision repair |
MW | 29.7 kDa |
Gene Summary | This gene encodes a member of the TFB4 family. The encoded protein is a subunit of the core-TFIIH basal transcription factor and localizes to the nucleus. The encoded protein is involved in RNA transcription by RNA polymerase II and nucleotide excision repair and associates with the Cdk-activating kinase complex. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 14. [provided by RefSeq, Dec 2012] Transcript Variant: This variant (2) lacks two in-frame exons but maintains the reading frame, compared to variant 1. This variant encodes isoform b, which is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232331 | GTF2H3 (Myc-DDK tagged) - Homo sapiens general transcription factor IIH, polypeptide 3, 34kDa (GTF2H3), transcript variant 2 |
CNY 3990.00 |
|
RG232331 | GTF2H3 (tGFP-tagged) - Homo sapiens general transcription factor IIH, polypeptide 3, 34kDa (GTF2H3), transcript variant 2 |
CNY 4370.00 |