GTF2H3 (NM_001271866) Human Untagged Clone

CAT#: SC330986

GTF2H3 (untagged) - Homo sapiens general transcription factor IIH, polypeptide 3, 34kDa (GTF2H3), transcript variant 2



  "NM_001271866" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


GTF2H3 mouse monoclonal antibody,clone OTI4B5
    • 100 ul

CNY 1999.00
CNY 2700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BTF2; P34; TFB4; TFIIH
Vector pCMV6-Entry
Sequence Data
>SC330986 representing NM_001271866.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTTTCAGACGAAGATGAATTGAATCTTCTGGTTATTGTAGTTGATGCCAACCCAATTTGGTGGGGA
AAGCAAGCATTAAAGGAATCTCAGTTCACTTTATCCAAATGCATAGATGCCGTGATGGTGCTGGGAAAT
TCGCATTTATTCATGAATCGTTCCAACAAACTTGCTGTGATAGCAAGTCACATTCAAGAAAGCCGATTC
TTATATCCTGGAAAGAATGGCAGACTTGGAGACTTCTTCGGAGACCCTGGCAACCCTCCTGAATTTAAT
CCCTCTGGGAGTAAAGATGGAAAATACGAACTTTTAACCTCAGCAAATGAAGTTATTGTTGAAGAGATT
AAAGATCTAATGACCAAAAGTGACATAAAGGGTCAACATACAGAAACTTTGCTGGCAGGATCCCTGGCC
AAAGCCCTTTGCTACATTCATAGAATGAACAAGGAAGTTAAAGACAATCAGGAAATGAAATCAAGGATA
TTGGCTTGTGACATCACGGGAGGACTGTACCTGAAGGTGCCTCAGATGCCTTCTCTTCTGCAGTATTTG
CTGTGGGTGTTTCTTCCCGATCAAGATCAGAGATCTCAGTTAATCCTCCCACCCCCAGTTCATGTTGAC
TACAGGGCTGCTTGCTTCTGTCATCGAAATCTCATTGAAATTGGTTATGTCTGTTCTGTGTGTTTGTCA
ATATTCTGCAATTTCAGCCCCATTTGTACTACGTGCGAGACAGCCTTTAAAATTTCTCTGCCTCCAGTG
CTGAAAGCCAAGAAAAAGAAACTGAAAGTGTCTGCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001271866
Insert Size 798 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271866.1
RefSeq Size 3305 bp
RefSeq ORF 798 bp
Locus ID 2967
UniProt ID Q13889
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Basal transcription factors, Nucleotide excision repair
MW 29.7 kDa
Gene Summary This gene encodes a member of the TFB4 family. The encoded protein is a subunit of the core-TFIIH basal transcription factor and localizes to the nucleus. The encoded protein is involved in RNA transcription by RNA polymerase II and nucleotide excision repair and associates with the Cdk-activating kinase complex. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 14. [provided by RefSeq, Dec 2012]
Transcript Variant: This variant (2) lacks two in-frame exons but maintains the reading frame, compared to variant 1. This variant encodes isoform b, which is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...