CIB2 (NM_001271889) Human Untagged Clone

CAT#: SC330996

CIB2 (untagged) - Homo sapiens calcium and integrin binding family member 2 (CIB2), transcript variant 3



  "NM_001271889" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CIB2 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DFNB48; KIP2; USH1J
Vector pCMV6-Entry
Sequence Data
>SC330996 representing NM_001271889.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGGAACAAGCAGACCATCTTCACCGAAGAGCAGCTAGACAACTACCAGGAGAATCCCTTCAAAGAA
AGGATCGTGGCGGCGTTTTCCGAGGATGGTGAGGGGAACCTCACTTTCAACGACTTTGTGGACATGTTT
TCCGTGCTCTGCGAGTCGGCTCCCCGAGAGCTCAAGGCAAACTATGCCTTCAAGATCTATGACTTCAAC
ACTGACAACTTCATCTGCAAGGAGGACCTGGAGCTGACGCTGGCCCGGCTCACTAAGTCAGAGCTGGAT
GAGGAGGAGGTGGTGCTTGTGTGCGACAAGGTCATTGAGGAGGCTGACTTGGACGGTGACGGCAAGCTG
GGCTTTGCTGACTTCGAGGACATGATTGCCAAGGCCCCTGACTTCCTCAGCACTTTCCACATCCGGATC
TGA

Restriction Sites SgfI-MluI     
ACCN NM_001271889
Insert Size 417 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001271889.1
RefSeq Size 1476 bp
RefSeq ORF 417 bp
Locus ID 10518
UniProt ID O75838
Protein Families Druggable Genome
MW 15.8 kDa
Gene Summary The protein encoded by this gene is similar to that of KIP/CIB, calcineurin B, and calmodulin. The encoded protein is a calcium-binding regulatory protein that interacts with DNA-dependent protein kinase catalytic subunits (DNA-PKcs), and it is involved in photoreceptor cell maintenance. Mutations in this gene cause deafness, autosomal recessive, 48 (DFNB48), and also Usher syndrome 1J (USH1J). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (3) lacks two alternate exons resulting in the loss of an in-frame segment in the 5' coding region, compared to variant 1. The encoded isoform (3) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...