S6K1 (RPS6KB1) (NM_001272043) Human Untagged Clone

CAT#: SC331027

RPS6KB1 (untagged) - Homo sapiens ribosomal protein S6 kinase, 70kDa, polypeptide 1 (RPS6KB1), transcript variant 3



  "NM_001272043" in other vectors (2)

CNY 4370.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
RPS6KB1 (S6K) mouse monoclonal antibody, clone OTI1G4 (formerly 1G4)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms p70 S6KA; p70(S6K)-alpha; p70-alpha; p70-S6K; PS6K; S6K; S6K-beta-1; S6K1; STK14A
Vector pCMV6-Entry
Sequence Data
>SC331027 representing NM_001272043.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGGCGACGAAGGAGGCGGGACGGCTTTTACCCAGCCCCGGACTTCCGAGACAGGGAAGCTGAGGAC
ATGGCAGGAGTGTTTGACATAGACCTGGACCAGCCAGAGGACGCGGGCTCTGAGGATGAGCTGGAGGAG
GGGGGTCAGTTAAATGAAAGCATGGACCATGGGGGAGTTGGACCATATGAACTTGGCATGGAACATTGT
GAGAAATTTGAAATCTCAGAAACTAGTGTGAACAGAGGGCCAGAAAAAATCAGACCAGAATGTTTTGAG
CTACTTCGGGTACTTGGTAAAGGGGGCTATGGAAAGGTTTTTCAAGTACGAAAAGTAACAGGAGCAAAT
ACTGGGAAAATATTTGCCATGAAGGTGCTTAAAAAGGCAATGATAGTAAGAAATGCTAAAGATACAGCT
CATACAAAAGCAGAACGGAATATTCTGGAGGAAGTAAAGCATCCCTTCATCGTGGATTTAATTTATGCC
TTTCAGACTGGTGGAAAACTCTACCTCATCCTTGAGTATCTCAGTGGAGGAGAACTATTTATGCAGTTA
GAAAGAGAGGGAATATTTATGGAAGACACTGCCTGCTTTTACTTGGCAGAAATCTCCATGGCTTTGGGG
CATTTACATCAAAAGGGGATCATCTACAGAGACCTGAAGCCGGAGAATATCATGCTTAATCACCAAGGT
CATGTGAAACTAACAGACTTTGGACTATGCAAAGAATCTATTCATGATGGAACAGTCACACACACATTT
TGTGGAACAATAGAATACATGGCCCCTGAAATCTTGATGAGAAGTGGCCACAATCGTGCTGTGGATTGG
TGGAGTTTGGGAGCATTAATGTATGACATGCTGACTGGAGCACCCCCATTCACTGGGGAGAATAGAAAG
AAAACAATTGACAAAATCCTCAAATGTAAACTCAATTTGCCTCCCTACCTCACACAAGAAGCCAGAGAT
CTGCTTAAAAAGCTGCTGAAAAGAAATGCTGCTTCTCGTCTGGGAGCTGGTCCTGGGGACGCTGGAGAA
GTTCAAGCTCATCCATTCTTTAGACACATTAACTGGGAAGAACTTCTGGCTCGAAAGGTGGAGCCCCCC
TTTAAACCTCTGTTGCAATCTGAAGAGGATGTAAGTCAGTTTGATTCCAAGTTTACACGTCAGACACCT
GTCGACAGCCCAGATGACTCAACTCTCAGTGAAAGTGCCAATCAGGTCTTTCTGGGTTTTACATATGTG
GCTCCATCTGTACTTGAAAGTGTGAAAGAAAAGTTTTCCTTTGAACCAAAAATCCGATCACCTCGAAGA
TTTATTGGCAGCCCACGAACACCTGTCAGTACTGCTATGTGCTAA

Restriction Sites SgfI-MluI     
ACCN NM_001272043
Insert Size 1356 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001272043.1
RefSeq Size 4332 bp
RefSeq ORF 1356 bp
Locus ID 6198
UniProt ID P23443
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Acute myeloid leukemia, ErbB signaling pathway, Fc gamma R-mediated phagocytosis, Insulin signaling pathway, mTOR signaling pathway, TGF-beta signaling pathway
MW 51 kDa
Gene Summary This gene encodes a member of the ribosomal S6 kinase family of serine/threonine kinases. The encoded protein responds to mTOR (mammalian target of rapamycin) signaling to promote protein synthesis, cell growth, and cell proliferation. Activity of this gene has been associated with human cancer. Alternatively spliced transcript variants have been observed. The use of alternative translation start sites results in isoforms with longer or shorter N-termini which may differ in their subcellular localizations. There are two pseudogenes for this gene on chromosome 17. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (3) differs in the 3' UTR and uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. This variant can initiate translation from two alternate in-frame AUG start codons. The isoform represented in this RefSeq (c) is derived from the first AUG start codon. It has a distinct C-terminus, and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...