HIRIP3 (NM_001197323) Human Untagged Clone

CAT#: SC331200

HIRIP3 (untagged) - Homo sapiens HIRA interacting protein 3 (HIRIP3), transcript variant 2



  "NM_001197323" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
HIRIP3 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
Sequence Data
>SC331200 representing NM_001197323.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGCGGGAGAAGGAGATGCAGGAGTTCACCCGTAGCTTCTTCCGAGGCCGCCCGGACCTCAGCACG
CTTACGCATTCCATCGTGCGGCGGAGGTACTTAGCTCACTCGGGCCGCAGCCACCTGGAGCCCGAGGAG
AAGCAGGCACTGAAGCGGCTGGTGGAGGAGGAGCTGCTGAAGATGCAGGTGGATGAAGCCGCTTCCAGG
GAAGACAAACTGGACCTTACCAAGAAGGGCAAGAGGCCTCCCACCCCTTGTAGCGACCCGGAGAGAAAA
AGGTTCCGCTTCAATTCAGAGTCGGGCTGGCTCAGGTCGCCGTGGAGAGGACCACCCGGCTGTGATGAG
GCTGAAGCGCTACATTCGGGCCTGTGGTGCCCATCGAAACTACAAGAAGCTGTTGGGCTCCTGTTGCTC
ACACAAGGAGCGCCTGAGTATCCTCCGGGCAGAACTGGAAGCGCTAGGCATGAAGGGTACCCCTTCCCT
AGGGAAGTGTCGGGCCCTGAAGGAGCAGAGGGAGGAGGCAGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001197323
Insert Size 528 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001197323.1
RefSeq Size 2127 bp
RefSeq ORF 528 bp
Locus ID 8479
UniProt ID Q9BW71
MW 19.7 kDa
Gene Summary The HIRA protein shares sequence similarity with Hir1p and Hir2p, the two corepressors of histone gene transcription characterized in the yeast, Saccharomyces cerevisiae. The structural features of the HIRA protein suggest that it may function as part of a multiprotein complex. Several cDNAs encoding HIRA-interacting proteins, or HIRIPs, have been identified. In vitro, the protein encoded by this gene binds HIRA, as well as H2B and H3 core histones, indicating that a complex containing HIRA-HIRIP3 could function in some aspects of chromatin and histone metabolism. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.[provided by RefSeq, Aug 2011]
Transcript Variant: This variant (2) lacks an exon in the coding region, resulting in frame-shift, compared to variant 1. The resulting isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...