UCH37 (UCHL5) (NM_001199261) Human Untagged Clone

CAT#: SC331282

UCHL5 (untagged) - Homo sapiens ubiquitin carboxyl-terminal hydrolase L5 (UCHL5), transcript variant 2



  "NM_001199261" in other vectors (2)

CNY 3230.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-UCHL5 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CGI-70; INO80R; UCH-L5; UCH37
Vector pCMV6-Entry
Sequence Data
>SC331282 representing NM_001199261.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACGGGCAATGCCGGGGAGTGGTGCCTCATGGAAAGCGACCCCGGGGTCTTCACCGAGCTCATTAAA
GGATTCGGTTGCCGAGGAGCCCAAGTAGAAGAAATATGGAGTTTAGAGCCTGAGAATTTTGAAAAATTA
AAGCCAGTTCATGGGTTAATTTTTCTTTTCAAGTGGCAGCCAGGAGAAGAACCAGCAGGCTCTGTGGTT
CAGGACTCCCGACTTGACACGATATTTTTTGCTAAGCAGGTAATTAATAATGCTTGTGCTACTCAAGCC
ATAGTGAGTGTGTTACTGAACTGTACCCACCAGGATGTCCATTTAGGCGAGACATTATCAGAGTTTAAA
GAATTTTCACAAAGTTTTGATGCAGCTATGAAAGGCTTGGCACTGAGCAATTCAGATGTGATTCGACAA
GTACACAACAGTTTCGCCAGACAGCAAATGTTTGAATTTGATACGAAGACATCAGCAAAAGAAGAAGAT
GCTTTTCACTTTGTCAGTTATGTTCCTGTTAATGGGAGACTGTATGAATTAGATGGATTAAGAGAAGGA
CCGATTGATTTAGGTGCATGCAATCAAGATGATTGGATCAGTGCAGTAAGGCCTGTCATAGAAAAAAGG
ATACAAAAGTACAGTGAAGGTGAAATTCGATTTAATTTAATGGCCATTGTGTCTGACAGAAAAATGATA
TATGAGCAGAAGATAGCAGAGTTACAAAGACAACTTGCAGAGGAACCCATGGATACAGATCAAGGTAAT
AGTATGTTAAGTGCTATTCAGTCAGAAGTTGCCAAAAATCAGATGCTTATTGAAGAAGAAGTACAGAAA
TTAAAAAGATACAAGATTGAGAATATCAGAAGGAAGCATAATTATCTGCCTTTCATTATGGAATTGTTA
AAGACTTTAGCAGAACACCAGCAGTTAATACCACTAGTAGAAAAGGCAAAAGAAAAACAGAACGCAAAG
AAAGCTCAGGAAACCAAATGA

Restriction Sites SgfI-MluI     
ACCN NM_001199261
Insert Size 987 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199261.1
RefSeq Size 5105 bp
RefSeq ORF 987 bp
Locus ID 51377
UniProt ID Q9Y5K5
Protein Families Druggable Genome, Protease
MW 37.5 kDa
Gene Summary Protease that specifically cleaves 'Lys-48'-linked polyubiquitin chains. Deubiquitinating enzyme associated with the 19S regulatory subunit of the 26S proteasome. Putative regulatory component of the INO80 complex; however is inactive in the INO80 complex and is activated by a transient interaction of the INO80 complex with the proteasome via ADRM1.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the central coding region, compared to variant 1. The resulting isoform (2) lacks one internal residue, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...