NCR2 (NM_001199510) Human Untagged Clone

CAT#: SC331322

NCR2 (untagged) - Homo sapiens natural cytotoxicity triggering receptor 2 (NCR2), transcript variant 3



  "NM_001199510" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
NCR2 mouse monoclonal antibody,clone OTI4B8
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD336; dJ149M18.1; LY95; NK-p44; NKP44
Vector pCMV6-Entry
Sequence Data
>SC331322 representing NM_001199510.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCTGGCGAGCCCTACACCCACTGCTACTGCTGCTGCTGCTGTTCCCAGGCTCTCAGGCACAATCC
AAGGCTCAGGTACTTCAAAGTGTGGCAGGGCAGACGCTAACCGTGAGATGCCAGTACCCGCCCACGGGC
AGTCTCTACGAGAAGAAAGGCTGGTGTAAGGAGGCTTCAGCACTTGTGTGCATCAGGTTAGTCACCAGC
TCCAAGCCCAGGACGATGGCTTGGACCTCTCGATTCACAATCTGGGACGACCCTGATGCTGGCTTCTTC
ACTGTCACCATGACTGATCTGAGAGAGGAAGACTCAGGACATTACTGGTGTAGAATCTACCGCCCTTCT
GACAACTCTGTCTCTAAGTCCGTCAGATTCTATCTGGTGGTATCTCCAGCCTCTGCCTCCACACAGACC
TCCTGGACTCCCCGCGACCTGGTCTCTTCACAGACCCAGACCCAGAGCTGTGTGCCTCCCACTGCAGGA
GCCAGACAAGCCCCTGAGTCTCCATCTACCATCCCTGTCCCTTCACAGCCACAGAACTCCACGCTCCGC
CCTGGCCCTGCAGCCCCCATTGCCCTGGTGCCTGTGTTCTGTGGACTCCTCGTAGCCAAGAGCCTGGTG
CTGTCAGCCCTGCTCGTCTGGTGGGTTTTAAGGAATCGGCACATGCAGCATCAAGGGAGGTCTCTGCTG
CACCCAGCTCAGCCCAGGCCCCAGGCCCATAGACACTTCCCACTGAGCCACAGGGCACCAGGGGGGACA
TATGGTGGAAAACCATGA

Restriction Sites SgfI-MluI     
ACCN NM_001199510
Insert Size 777 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199510.1
RefSeq Size 1048 bp
RefSeq ORF 777 bp
Locus ID 9436
UniProt ID O95944
Protein Families Druggable Genome, Transmembrane
Protein Pathways Natural killer cell mediated cytotoxicity
MW 28.4 kDa
Gene Summary Cytotoxicity-activating receptor that may contribute to the increased efficiency of activated natural killer (NK) cells to mediate tumor cell lysis.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) has an additional exon which results in frame-shift, as compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus, as compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...