FUS2 (NAT6) (NM_001200016) Human Untagged Clone

CAT#: SC331398

NAT6 (untagged) - Homo sapiens N-acetyltransferase 6 (GCN5-related) (NAT6), transcript variant 2



  "NM_001200016" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-NAT6 Antibody
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FUS-2; FUS2; HsNAAA80; NAT6
Vector pCMV6-Entry
Sequence Data
>SC331398 representing NM_001200016.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGCTGATCCTGAGTACCAGCCCAGCTGAGCTGACTCTGGATCCTGCGTGCCAGCCAAAGCTGCCC
CTGGATTCCACATGCCAACCAGAGATGACCTTCAATCCTGGTCCAACTGAGCTTACCCTGGATCCTGAA
CACCAGCCAGAGGAGACCCCAGCTCCTAGCCTGGCTGAGTTGACCCTGGAGCCTGTGCACCGCCGACCC
GAGCTCCTGGATGCTTGTGCTGACCTCATCAATGATCAGTGGCCCCGCAGCCGCACCTCCCGCCTGCAC
TCCCTGGGCCAGTCCTCAGATGCCTTCCCCCTCTGCCTGATGCTGCTAAGCCCCCACCCCACACTTGAA
GCAGCACCCGTTGTGGTGGGCCATGCCCGCCTGTCACGGGTGCTGAACCAGCCCCAGAGCCTCTTAGTG
GAGACAGTGGTGGTGGCCCGGGCCCTGAGGGGCCGTGGCTTTGGCCGCCGCCTCATGGAGGGCCTGGAG
GTCTTTGCTCGGGCCCGGGGCTTCCGCAAGCTGCATCTCACCACCCATGACCAGGTGCACTTCTATACC
CACCTGGGCTACCAGCTGGGTGAGCCTGTGCAGGGCCTGGTCTTCACCAGCAGACGGCTGCCTGCCACC
CTGCTTAATGCCTTCCCCACAGCCCCCTCTCCCCGGCCACCCAGGAAGGCCCCAAACCTGACTGCCCAA
GCTGCCCCAAGGGGTCCCAAGGGACCTCCATTGCCACCACCCCCTCCCCTACCTGAGTGCCTGACCATC
TCACCCCCAGTTCCATCAGGGCCCCCTTCAAAAAGCCTGCTGGAGACACAATATCAAAATGTGAGGGGG
CGCCCCATATTCTGGATGGAAAAAGACATCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001200016
Insert Size 861 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001200016.1
RefSeq Size 1497 bp
RefSeq ORF 861 bp
Locus ID 24142
UniProt ID Q93015
Protein Pathways Glycerophospholipid metabolism, Limonene and pinene degradation, Phenylalanine metabolism, Tyrosine metabolism
MW 31.4 kDa
Gene Summary This gene encodes a member of the N-acetyltransferase family. N-acetyltransferases modify proteins by transferring acetyl groups from acetyl CoA to the N-termini of protein substrates. The encoded protein is a cytoplasmic N-acetyltransferase with a substrate specificity for proteins with an N-terminal methionine. This gene is located in the tumor suppressor gene region on chromosome 3p21.3 and the encoded protein may play a role in cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed. This gene overlaps and is on the same strand as hyaluronoglucosaminidase 3, and some transcripts of each gene share a portion of the first exon. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (2) contains an alternate splice site in the 5' UTR and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...