ABH2 (ALKBH2) (NM_001205179) Human Untagged Clone

CAT#: SC331635

ALKBH2 (untagged) - Homo sapiens alkB, alkylation repair homolog 2 (E. coli) (ALKBH2), transcript variant 4



  "NM_001205179" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal ALKBH2 Antibody
    • 100 ug

CNY 5808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ABH2
Vector pCMV6-Entry
Sequence Data
>SC331635 representing NM_001205179.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGACAGATTCCTGGTGAAAGGGGCTCAAGGGGGCCTTTTGAGGAAGCAGGAGGAGCAAGAGCCAACT
GGAGAAGAGCCAGCTGTGTTGGGAGGAGACAAAGAAAGCACAAGGAAGAGGCCCAGGAGAGAGGCCCCA
GGGAATGGAGGCCACTCAGCAGGCCCTAGCTGGCGGCACATTCGGGCTGAGGGCCTGGACTGCAGTTAC
ACAGTCCTGTTTGGCAAAGCTGAGGCAGATGAGATTTTCCAAGAGTTGGAGAAAGAAGTAGAATATTTT
ACAGGTATAAAGATGGCTGTGACCACATCGGGGAGCACCGAGATGATGAAAGAGAACTGGCCCCTGGGA
GCCCCATTGCCTCTGTCTCCTTCGGTGCCTGCAGAGACTTTGTCTTCCGGCATAAGGATTCCCGTGGGA
AAAGCCCCTCCAGGAGGGTGGCGGTGGTCAGGCTGCCGCTGGCCCACGGGAGCTTACTAA

Restriction Sites SgfI-MluI     
ACCN NM_001205179
Insert Size 474 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001205179.1
RefSeq Size 904 bp
RefSeq ORF 474 bp
Locus ID 121642
UniProt ID Q6NS38
Protein Families Druggable Genome
MW 17.1 kDa
Gene Summary The Escherichia coli AlkB protein protects against the cytotoxicity of methylating agents by repair of the specific DNA lesions generated in single-stranded DNA. ALKBH2 and ALKBH3 (MIM 610603) are E. coli AlkB homologs that catalyze the removal of 1-methyladenine and 3-methylcytosine (Duncan et al., 2002 [PubMed 12486230]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (4) differs in the 5' UTR and lacks a coding exon compared to variant 1. The resulting protein (isoform 2) is shorter but has the same N- and C-termini compared to isoform 1. Variants 4 and 5 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...