IRAG1 (NM_001206881) Human Untagged Clone

CAT#: SC331698

MRVI1 (untagged) - Homo sapiens murine retrovirus integration site 1 homolog (MRVI1), transcript variant 6



  "NM_001206881" in other vectors (2)

CNY 5800.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-MRVI1 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms IRAG; JAW1L; MRVI1
Vector pCMV6-Entry
Sequence Data
>SC331698 representing NM_001206881.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCCTGAACAGCCCTCAGCCTGGCCCCGTGGAGAGCGAGCTGGGGAAGCAGCTCTTGAAAACGGGC
TGGGAGGGCAGCCCTCTGCCGAGAAGTCCAACCCAGGATGCGGCAGGAGTGGGTCCCCCAGCCTCCCAG
GGGAGAGGCCCAGCTGGAGAGCCGATGGGGCCCGAGGCTGGCTCCAAAGCTGAGCTTCCACCCACTGTG
TCCCGGCCCCCGCTGCTGCGAGGGCTCTCCTGGGACAGTGGCCCTGAAGAACCTGGCCCCCGGCTGCAG
AAAGTGCTTGCCAAGCTGCCACTGGCAGAGGAAGAAAAGCGTTTTGCAGGCAAGGCCGGCGGCAAGCTG
GCCAAGGCCCCTGGTCTCAAAGACTTTCAGATACAAGTGCAGCCCGTGCGGATGCAGAAACTGACCAAG
CTCCGAGAGGAGCACATCCTGATGAGAAATCAGAACTTAGTGGGGCTCAAGCTTCCAGACCTTAGTGAA
GCAGCTGAGCAGGAAAAAGGGCTTCCTTCTGAACTCTCCCCAGCTATTGAGGAAGAAGAGTCAAAGAGT
GGCTTAGATGTCATGCCTAATATTTCTGATGTGCTGCTGCGCAAACTGCGGGTCCACAGGAGTCTCCCT
GGAAGTGCCCCTCCACTCACTGAAAAGGAAGTTGAGAACGTGTTTGTGCAACTGTCCTTGGCCTTTAGA
AATGACAGCTACACTCTGGAATCTAGAATTAACCAGGCTGAAAGGGAACGCAACCTGACAGAGGAGAAC
ACTGAGAAAGAACTGGAAAACTTCAAAGCTTCCATTACGTCCTCAGCTTCACTCTGGCACCACTGTGAG
CACCGGGAAACCTACCAGAAGTTGCTGGAGGACATCGCTGTCCTGCACCGCCTGGCTGCCCGCCTCTCC
AGCCGAGCTGAGGTGGTAGGCGCCGTCCGCCAGGAAAAGCGCATGTCGAAAGCAACGGAAGTGATGATG
CAGTATGTGGAGAATCTAAAGAGGACGTATGAGAAGGACCATGCGGAGCTCATGGAGTTTAAAAAGCTT
GCAAATCAGAATTCAAGCCGCAGCTGTGGCCCCTCTGAAGATGGGGTCCCTCGCACGGCACGGTCCATG
TCCCTCACGCTGGGAAAGAATATGCCTCGCCGGAGGGTCAGCGTTGCTGTGGTTCCTAAGTTTAATGCC
CTGAATCTGCCTGGCCAAACTCCCAGCTCATCATCCATTCCCTCCTTACCAGCCTTGTCGGAATCACCC
AATGGGAAAGGCAGCCTACCTGTCACTTCAGCACTGCCTGCACTTTTGGAAAATGGAAAGACAAATGGG
GACCCAGATTGTGAAGCCTCTGCTCCTGCGCTGACCCTGAGCTGCCTGGAGGAGCTTAGTCAGGAGACC
AAGGCCAGGATGGAGGAAGAAGCCTACAGCAAGGGATTCCAAGAAGGTCTAAAGAAGACCAAAGAACTT
CAAGACCTGAAGGAGGAGGAGGAAGAACAGAAGAGTGAGAGTCCTGAGGAACCTGAAGAGGTAGAAGAA
ACTGAGGAAGAGGAAAAGGGCCCAAGAAGCAGCAAACTTGAAGAATTGGTCCATTTCTTACAAGTCATG
TATCCCAAACTGTGTCAGCACTGGCAAGTGATCTGGATGATGGCTGCAGTGATGCTGGTCTTGACTGTT
GTGCTGGGGCTCTACAATTCCTATAACTCTTGTGCAGAGCAGGCTGATGGGCCCCTTGGAAGATCCACT
TGCTCGGCAGCCCAGAGGGACTCCTGGTGGAGCTCAGGACTCCAGCATGAGCAGCCTACAGAGCAGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001206881
Insert Size 1794 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001206881.1
RefSeq Size 6165 bp
RefSeq ORF 1794 bp
Locus ID 10335
UniProt ID Q9Y6F6
Protein Families Transmembrane
Protein Pathways Vascular smooth muscle contraction
MW 65.9 kDa
Gene Summary This gene is similar to a putative mouse tumor suppressor gene (Mrvi1) that is frequently disrupted by mouse AIDS-related virus (MRV). The encoded protein, which is found in the membrane of the endoplasmic reticulum, is similar to Jaw1, a lymphoid-restricted protein whose expression is down-regulated during lymphoid differentiation. This protein is a substrate of cGMP-dependent kinase-1 (PKG1) that can function as a regulator of IP3-induced calcium release. Studies in mouse suggest that MRV integration at Mrvi1 induces myeloid leukemia by altering the expression of a gene important for myeloid cell growth and/or differentiation, and thus this gene may function as a myeloid leukemia tumor suppressor gene. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene, and alternative translation start sites, including a non-AUG (CUG) start site, are used. [provided by RefSeq, May 2011]
Transcript Variant: This variant (6) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (c) is shorter at the N-terminus, compared to isoform a. Both variants 4 and 6 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: This CCDS representation uses a downstream AUG start codon compared to CCDS44539.1. It is supported by the mRNA AK127209.1, which lacks the exon containing the alternative non-AUG (CUG) start codon described in PMID:10321731.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...