CDHH (CDH13) (NM_001220490) Human Untagged Clone

CAT#: SC331767

CDH13 (untagged) - Homo sapiens cadherin 13 (CDH13), transcript variant 4



  "NM_001220490" in other vectors (2)

CNY 4370.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Anti-CDH13 (H Cadherin) mouse monoclonal antibody, clone OTI3H6 (formerly 3H6)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CDHH; P105
Vector pCMV6-Entry
Sequence Data
>SC331767 representing NM_001220490.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAAGGGTCACCCACAGGCACCACAGTGATGCGGATGACAGCCTTTGATGCAGATGACCCAGCCACC
GATAATGCCCTCCTGCGGTATAATATCCGTCAGCAGACGCCTGACAAGCCATCTCCCAACATGTTCTAC
ATCGATCCTGAGAAAGGAGACATTGTCACTGTTGTGTCACCTGCGCTGCTGGACCGAGAGACTCTGGAA
AATCCCAAGTATGAACTGATCATCGAGGCTCAAGATATGGCTGGACTGGATGTTGGATTAACAGGCACG
GCCACAGCCACGATCATGATCGATGACAAAAATGATCACTCACCAAAATTCACCAAGAAAGAGTTTCAA
GCCACAGTCGAGGAAGGAGCTGTGGGAGTTATTGTCAATTTGACAGTTGAAGATAAGGATGACCCCACC
ACAGGTGCATGGAGGGCTGCCTACACCATCATCAACGGAAACCCCGGGCAGAGCTTTGAAATCCACACC
AACCCTCAAACCAACGAAGGGATGCTTTCTGTTGTCAAACCATTGGACTATGAAATTTCTGCCTTCCAC
ACCCTGCTGATCAAAGTGGAAAATGAAGACCCACTCGTACCCGACGTCTCCTACGGCCCCAGCTCCACA
GCCACCGTCCACATCACTGTCCTGGATGTCAACGAGGGCCCAGTCTTCTACCCAGACCCCATGATGGTG
ACCAGGCAGGAGGACCTCTCTGTGGGCAGCGTGCTGCTGACAGTGAATGCCACGGACCCCGACTCCCTG
CAGCATCAAACCATCAGGTATTCTGTTTACAAGGACCCAGCAGGTTGGCTGAATATTAACCCCATCAAT
GGGACTGTTGACACCACAGCTGTGCTGGACCGTGAGTCCCCATTTGTCGACAACAGCGTGTACACTGCT
CTCTTCCTGGCAATTGACAGTGGCAACCCTCCCGCTACGGGCACTGGGACTTTGCTGATAACCCTGGAG
GACGTGAATGACAATGCCCCGTTCATTTACCCCACAGTAGCTGAAGTCTGTGATGATGCCAAAAACCTC
AGTGTAGTCATTTTGGGAGCATCAGATAAGGATCTTCACCCGAATACAGATCCTTTCAAATTTGAAATC
CACAAACAAGCTGTTCCTGATAAAGTCTGGAAGATCTCCAAGATCAACAATACACACGCCCTGGTAAGC
CTTCTTCAAAATCTGAACAAAGCAAACTACAACCTGCCCATCATGGTGACAGATTCAGGGAAACCACCC
ATGACGAATATCACAGATCTCAGGGTACAAGTGTGCTCCTGCAGGAATTCCAAAGTGGACTGCAACGCG
GCAGGGGCCCTGCGCTTCAGCCTGCCCTCAGTCCTGCTCCTCAGCCTCTTCAGCTTAGCTTGTCTGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001220490
Insert Size 1380 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001220490.1
RefSeq Size 3819 bp
RefSeq ORF 1380 bp
Locus ID 1012
MW 50 kDa
Gene Summary This gene encodes a member of the cadherin superfamily. The encoded protein is localized to the surface of the cell membrane and is anchored by a GPI moiety, rather than by a transmembrane domain. The protein lacks the cytoplasmic domain characteristic of other cadherins, and so is not thought to be a cell-cell adhesion glycoprotein. This protein acts as a negative regulator of axon growth during neural differentiation. It also protects vascular endothelial cells from apoptosis due to oxidative stress, and is associated with resistance to atherosclerosis. The gene is hypermethylated in many types of cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2011]
Transcript Variant: This variant (4) lacks an exon in the coding region resulting in use of a downstream start codon, compared to variant 1. It encodes isoform 4, which is shorter and has a distinct N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...