RNF41 (NM_001242826) Human Untagged Clone

CAT#: SC331887

RNF41 (untagged) - Homo sapiens ring finger protein 41 (RNF41), transcript variant 4



  "NM_001242826" in other vectors (2)

CNY 3140.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
RNF41 mouse monoclonal antibody,clone OTI2C1
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FLRF; NRDP1; SBBI03
Vector pCMV6-Entry
Sequence Data
>SC331887 representing NM_001242826.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGGTATGATGTAACCCGTTTCCAGGGGGATGTTGACGAAGATCTTATCTGCCCTATTTGCAGTGGA
GTCTTGGAGGAGCCAGTACAGGCACCTCATTGTGAACATGCTTTCTGCAACGCCTGCATCACCCAGTGG
TTCTCTCAGCAACAGACATGTCCAGTGGACCGTAGTGTTGTGACGGTCGCCCATCTGCGCCCAGTACCT
CGGATCATGCGGAACATGTTGTCAAAGCTGCAGATTGCCTGTGACAACGCTGTGTTCGGCTGTAGTGCC
GTTGTCCGGCTTGACAACCTCATGTCTCACCTCAGCGACTGTGAGCACAACCCGAAGCGGCCTGTGACC
TGTGAACAGGGCTGTGGCCTGGAGATGCCCAAAGATGAGCTGCCCAACCATAACTGCATTAAGCACCTG
CGCTCAGTGGTACAGCAGCAGCAGACACGCATCGCAGAGCTGGAGAAGACGTCAGCTGAACACAAACAC
CAGCTGGCGGAGCAGAAGCGAGACATCCAGCTGCTAAAGGCATACATGCGTGCAATCCGCAGTGTCAAC
CCCAACCTTCAGAACCTGGAGGAGACAATTGAATACAACGAGATCCTAGAGTGGGTGAACTCCCTTCAG
CCAGCAAGAGTGACCCGCTGGGGAGGGATGATCTCGACTCCTGATGCTGTGCTCCAGGCTGTAATCAAG
CGCTCCCTGGTGGAGAGTGGCTGTCCTGCTTCTATTGTCAACGAGCTGATTGAAAATGCCCACGAGCGT
AGCTGGCCCCAGGGTCTGGCCACACTAGAGACTAGACAGATGAACCGACGCTACTATGAGAACTACGTG
GCCAAGCGCATCCCTGGCAAGCAGGCTGTTGTCGTGATGGCCTGTGAGAACCAGCACATGGGGGATGAC
ATGGTGCAAGAGCCAGGCCTTGTCATGATATTTGCGCATGGCGTGGAAGAGATATAA

Restriction Sites SgfI-MluI     
ACCN NM_001242826
Insert Size 954 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001242826.1
RefSeq Size 5216 bp
RefSeq ORF 954 bp
Locus ID 10193
UniProt ID Q9H4P4
Protein Pathways Endocytosis
MW 35.9 kDa
Gene Summary This gene encodes an E3 ubiquitin ligase. The encoded protein plays a role in type 1 cytokine receptor signaling by controlling the balance between JAK2-associated cytokine receptor degradation and ectodomain shedding. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]
Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1, 3 and 4 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...