EPDR1 (NM_001242946) Human Untagged Clone
CAT#: SC331935
EPDR1 (untagged) - Homo sapiens ependymin related 1 (EPDR1), transcript variant 2
CNY 2950.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | EPDR; MERP-1; MERP1; UCC1 |
Vector | pCMV6-Entry |
Sequence Data |
>SC331935 representing NM_001242946.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGCCAGGACGCGCTCCCCTCCGCACCGTCCCGGGCGCCCTGGGTGCCTGGCTGCTGGGCGGCCTCTGG GCCTGGACCCTGTGCGGCCTGTGCAGCCTGGGGGCGGTGGGAGCCCCGCGCCCGTGCCAGGCGCCGCAG CAGTGGGAGGGGCGCCAGGTTATGTACCAGCAAAGTAGCGGGCGCAACAGCCGCGCCCTGCTCTCCTAC GACGGGCTCAACCAGCGCGTGCGGGTGCTGGACGAGAGGAAGGCGCTGATCCCCTGCAAGAGATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001242946 |
Insert Size | 273 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001242946.1 |
RefSeq Size | 2405 bp |
RefSeq ORF | 273 bp |
Locus ID | 54749 |
UniProt ID | Q9UM22 |
Protein Families | Secreted Protein |
MW | 9.9 kDa |
Gene Summary | The protein encoded by this gene is a type II transmembrane protein that is similar to two families of cell adhesion molecules, the protocadherins and ependymins. This protein may play a role in calcium-dependent cell adhesion. This protein is glycosylated, and the orthologous mouse protein is localized to the lysosome. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 8. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (2) lacks an alternate exon that results in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (2, also known as MERP1a) has a distinct and shorter C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...