TRA2B (NM_001243879) Human Untagged Clone

CAT#: SC332051

TRA2B (untagged) - Homo sapiens transformer 2 beta homolog (Drosophila) (TRA2B), transcript variant 2



  "NM_001243879" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-SFRS10 Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Htra2-beta; PPP1R156; SFRS10; SRFS10; TRA2-BETA; TRAN2B
Vector pCMV6-Entry
Sequence Data
>SC332051 representing NM_001243879.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCTACTCGCAGGCGTCATGTTGGGAATCGGGCAAATCCTGATCCTAACTGTTGTCTTGGAGTATTT
GGGCTGAGCTTGTACACCACAGAAAGAGATCTAAGAGAAGTGTTCTCTAAATATGGTCCCATTGCCGAT
GTGTCTATTGTATATGACCAGCAGTCTAGGCGTTCAAGAGGATTTGCCTTTGTATATTTTGAAAATGTA
GATGATGCCAAGGAAGCTAAAGAACGTGCCAATGGAATGGAGCTTGATGGGCGTAGGATCAGAGTTGAT
TTCTCTATAACAAAAAGACCACATACGCCAACACCAGGAATTTACATGGGGAGACCTACCTATGGCAGC
TCTCGCCGTCGGGATTACTATGACAGAGGATATGATCGGGGCTATGATGATCGGGACTACTATAGCAGA
TCATACAGAGGAGGAGGTGGAGGAGGAGGAGGATGGAGAGCTGCCCAAGACAGGGATCAGATTTATAGA
AGGCGGTCACCTTCTCCTTACTATAGTCGTGGAGGATACAGATCACGTTCCAGATCTCGATCATACTCA
CCTCGTCGCTATTAA

Restriction Sites SgfI-MluI     
ACCN NM_001243879
Insert Size 567 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001243879.1
RefSeq Size 4156 bp
RefSeq ORF 567 bp
Locus ID 6434
UniProt ID P62995
Protein Families Druggable Genome
Protein Pathways Spliceosome
MW 21.9 kDa
Gene Summary This gene encodes a nuclear protein which functions as sequence-specific serine/arginine splicing factor which plays a role in mRNA processing, splicing patterns, and gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (2) lacks an alternate exon in the 5' coding region and uses a downstream start codon, compared to variant 1. Isoform 2 has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...