POU2F3 (NM_001244682) Human Untagged Clone

CAT#: SC332081

POU2F3 (untagged) - Homo sapiens POU class 2 homeobox 3 (POU2F3), transcript variant 2



  "NM_001244682" in other vectors (2)

CNY 4280.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-POU2F3 Antibody
    • 50 ug

CNY 5200.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Epoc-1; OCT-11; OCT11; OTF-11; PLA-1; PLA1; Skn-1a
Vector pCMV6-Entry
Sequence Data
>SC332081 representing NM_001244682.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGTCTCCAAGAACTGCTAAAGGAGGAAGGGATATCAAGATGAGTGGGGATGTAGCCGATTCCACG
GATGCTCGCAGCACTCTCAGCCAGGTGGAGCCAGGAAATGATCGAAATGGCCTAGATTTCAACAGGCAG
ATTAAAACCGAAGATCTCAGTGACTCCCTGCAGCAGACCCTCTCCCATCGGCCATGCCACCTGAGTCAA
GGACCTGCCATGATGTCCGGAAACCAAATGTCTGGGCTAAATGCCAGCCCATGTCAGGACATGGCTTCC
CTCCATCCGCTCCAGCAGCTTGTGCTGGTTCCCGGCCACTTACAGTCTGTATCCCAGTTCCTGCTATCT
CAGACCCAGCCTGGGCAGCAAGGTCTGCAGCCAAATCTCCTCCCCTTTCCACAGCAACAAAGCGGTCTC
CTCCTCCCACAGACTGGGCCGGGACTGGCATCCCAGGCATTTGGGCACCCTGGGCTGCCAGGATCCTCT
TTAGAACCCCACCTGGAAGCATCCCAGCATCTCCCAGTGCCCAAGCATCTACCCAGCTCTGGAGGGGCC
GATGAGCCCAGTGACCTCGAGGAGCTGGAGAAGTTTGCCAAGACCTTCAAGCAGAGGCGCATTAAGCTG
GGCTTCACACAGGGAGATGTGGGGCTGGCGATGGGAAAGCTGTATGGCAACGACTTCAGCCAGACCACC
ATCTCACGATTTGAGGCCCTCAACCTGAGCTTCAAGAACATGTGCAAGCTCAAGCCCCTGCTGGAGAAG
TGGCTGAATGATGCAGAGTCCTCTCCGTCAGACCCCTCAGTGAGCACGCCCAGCTCCTACCCCAGCCTC
AGTGAAGTATTTGGTAGGAAGAGAAAGAAACGGACCAGCATCGAGACCAACATCCGCCTGACTCTGGAG
AAGAGGTTTCAAGATAACCCAAAACCCAGCTCGGAGGAGATCTCCATGATTGCAGAGCAGTTGTCCATG
GAGAAGGAGGTGGTGAGGGTCTGGTTCTGCAACCGACGCCAAAAGGAGAAGCGAATCAACTGCCCTGTG
GCCACACCCATCAAACCACCTGTCTACAACTCCCGGCTGGTATCTCCCTCAGGGTCTCTGGGCCCCCTC
TCTGTCCCTCCTGTCCACAGTACCATGCCTGGAACAGTAACGTCATCCTGTTCCCCTGGGAACAACAGC
AGGCCTTCATCTCCTGGCTCAGGACTCCACGCCAGCAGCCCCACTGCATCTCAAAATAACTCCAAAGCA
GCAGTGAACTCCGCCTCCAGTTTTAACTCTTCAGGATCTTGGTACCGATGGAATCATTCCACCTACCTC
CACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001244682
Insert Size 1317 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001244682.1
RefSeq Size 2903 bp
RefSeq ORF 1317 bp
Locus ID 25833
UniProt ID Q9UKI9
MW 47.6 kDa
Gene Summary This gene encodes a member of the POU domain family of transcription factors. POU domain transcription factors bind to a specific octamer DNA motif and regulate cell type-specific differentiation pathways. The encoded protein is primarily expressed in the epidermis, and plays a critical role in keratinocyte proliferation and differentiation. The encoded protein is also a candidate tumor suppressor protein, and aberrant promoter methylation of this gene may play a role in cervical cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and uses an alternate start codon, compared to variant 1. The encoded isoform (2) is longer and has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...