SET (NM_001248001) Human Untagged Clone

CAT#: SC332124

SET (untagged) - Homo sapiens SET nuclear oncogene (SET), transcript variant 4



  "NM_001248001" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
SET/TAF1 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms 2PP2A; I2PP2A; IGAAD; IPP2A2; MRD58; PHAPII; TAF-I; TAF-IBETA
Vector pCMV6-Entry
Sequence Data
>SC332124 representing NM_001248001.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGATGCCTCGCTCCCATCAGCCGCCGCCGCCGCCACATGAAAAAGAACAGCAAGAAGCGATTGAACAC
ATTGATGAAGTACAAAATGAAATAGACAGACTTAATGAACAAGCCAGTGAGGAGATTTTGAAAGTAGAA
CAGAAATATAACAAACTCCGCCAACCATTTTTTCAGAAGAGGTCAGAATTGATCGCCAAAATCCCAAAT
TTTTGGGTAACAACATTTGTCAACCATCCACAAGTGTCTGCACTGCTTGGGGAGGAAGATGAAGAGGCA
CTGCATTATTTGACCAGAGTTGAAGTGACAGAATTTGAAGATATTAAATCAGGTTACAGAATAGATTTT
TATTTTGATGAAAATCCTTACTTTGAAAATAAAGTTCTCTCCAAAGAATTTCATCTGAATGAGAGTGGT
GATCCATCTTCGAAGTCCACCGAAATCAAATGGAAATCTGGAAAGGATTTGACGAAACGTTCGAGTCAA
ACGCAGAATAAAGCCAGCAGGAAGAGGCAGCATGAGGAACCAGAGAGCTTCTTTACCTGGTTTACTGAC
CATTCTGATGCAGGTGCTGATGAGTTAGGAGAGGTCATCAAAGATGATATTTGGCCAAACCCATTACAG
TACTACTTGGTTCCCGATATGGATGATGAAGAAGGAGAAGGAGAAGAAGATGATGATGATGATGAAGAG
GAGGAAGGATTAGAAGATATTGACGAAGAAGGGGATGAGGATGAAGGTGAAGAAGATGAAGATGATGAT
GAAGGGGAGGAAGGAGAGGAGGATGAAGGAGAAGATGACTAA

Restriction Sites SgfI-MluI     
ACCN NM_001248001
Insert Size 801 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001248001.1
RefSeq Size 2562 bp
RefSeq ORF 801 bp
Locus ID 6418
UniProt ID Q01105
Protein Families Druggable Genome, Phosphatase, Stem cell - Pluripotency
MW 31.1 kDa
Gene Summary The protein encoded by this gene inhibits acetylation of nucleosomes, especially histone H4, by histone acetylases (HAT). This inhibition is most likely accomplished by masking histone lysines from being acetylated, and the consequence is to silence HAT-dependent transcription. The encoded protein is part of a complex localized to the endoplasmic reticulum but is found in the nucleus and inhibits apoptosis following attack by cytotoxic T lymphocytes. This protein can also enhance DNA replication of the adenovirus genome. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (4) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (4) has a shorter and distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...