LCN1 (NM_001252619) Human Untagged Clone

CAT#: SC332205

LCN1 (untagged) - Homo sapiens lipocalin 1 (LCN1), transcript variant 4



  "NM_001252619" in other vectors (2)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-LCN1 Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PMFA; TLC; TP; VEGP
Vector pCMV6-Entry
Sequence Data
>SC332205 representing NM_001252619.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAGCCCCTGCTCCTGGCCGTCAGCCTTGGCCTCATTGCTGCCCTGCAGGCCCACCACCTCCTGGCC
TCAGACGAGGAGATTCAGGATGTGTCAGGGACGTGGTATCTGAAGGCCATGACGGTGGACAGGGAGTTC
CCTGAGATGAATCTGGAATCGGTGACACCCATGACCCTCACGACCCTGGAAGGGGGCAACCTGGAAGCC
AAGGTCACCATGCTGATAAGTGGCCGGTGCCAGGAGGTGAAGGCCGTCCTGGAGAAAACTGACGAGCCG
GGAAAATACACGGCCGACGGGGGCAAGCACGTGGCATACATCATCAGGTCGCACGTGAAGGACCACTAC
ATCTTTTACTGTGAGGGCGAGCTGCACGGGAAGCCGGTCCGAGGGGCAGAGACCCCAAGAACAACCTGG
AAGCCTTGGAGGACTTTGAGAAAGCCGCAGGAGCCCGCGGACTCAGCACGGAGAGCATCCTCATCCCCA
GGCAGAGCGAAACCTGCTCTCCAGGGAGCGATTAGGGGCAGGGGACACCTTGGCTCCTCAGCAGCCCAA
GGACGGCACCATCCAGCACCTCCGTCATTCACAGGGACATGGAAAAAGCTCCCCACCCCTGCAGAACGC
GGCTGGCTGCACCCCTTCCTACCACCCCCCGCCTTCCCCCTGCCCTGCGCCCCCTCTCCTGGTTCTCCA
TAA

Restriction Sites SgfI-MluI     
ACCN NM_001252619
Insert Size 693 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001252619.1
RefSeq Size 776 bp
RefSeq ORF 693 bp
Locus ID 3933
UniProt ID P31025
Protein Families Secreted Protein
MW 25.1 kDa
Gene Summary This gene encodes a member of the lipocalin family of small secretory proteins. Lipocalins are extracellular transport proteins that bind to a variety of hydrophobic ligands. The encoded protein is the primary lipid binding protein in tears and is overproduced in response to multiple stimuli including infection and stress. The encoded protein may be a marker for chromosome aneuploidy as well as an autoantigen in Sjogren's syndrome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and two pseudogenes of this gene are also located on the long arm of chromosome 9. [provided by RefSeq, Nov 2011]
Transcript Variant: This variant (4) uses an alternate splice site in the 3' coding region, which results in a translational frameshift, compared to variant 1. The encoded isoform (3) is longer and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...